In a disorder called gyrate atrophy, cells in the retina begin to degenerate in late adolescence, causing night blindness that progresses to total blindness.  The cause is a mutation in the gene that encodes an enzyme, ornithine aminotransferase (OAT).  Researchers sequenced the OAT gene for 5 patients with the following results: Patient A:  A change in codon 209 of UAU to UAA Patient B:  A change in codon 299 of UAC to UAG Patient C:  A change in codon 426 of CGA to UGA Patient D:  A two-nucleotide deletion at codons 64 and 65 that results in a UGA codon at position 79. Patient E:  Exon 6, including 1071 nucleotides is entirely deleted. Which patient(s) have a frameshift mutation? How many amino acids is patient E missing? Which patient(s) will produce a shortened protein?

Q: Mutation of codon 34 (CAC to GAC) and 85 (CGT to CAT) of the insulin gene causes hyperinsulinemia…

A: In codon 34, CAC codes for the amino acid Histidine. CAC is replaced by GAC which codes for Aspartic…

Q: Why is the TAS2R38 gene also called the PTC gene

A: PTC is a chemical compound abbreviated as phenylthiocarbamide. It is also called phenylthiourea as…

Q: A gene encodes a protein with the following amino acid sequence: Met-Lys-Ser-Pro-Ala-Thr-Pro A…

A: Given gene sequence: Met-Lys-Ser-Pro-Ala-Thr-Pro the gene then produces a protein with the amino…

Q: a. Which gene is mutated in individuals with sickle-cell anemia? b. What are the major symptoms of…

A: Hi! Thanks for your question. As you have posted multiple questions and have not mentioned which one…

Q: Ochre and amber are two distinct nonsense mutations. Before the genetic code was worked out, Sydney…

A: Gene expression is a process by which genetic information from a gene is used for the production of…

Q: A genetic researcher notices that individuals with a particular genetic disease have a shortened…

A: Silent Mutation : As the name says silent mutation, these are the mutations in DNA which doesn't…

Q: Why is the base pairing in D N A important? How does mRNA production in eukaryotes differ from the…

A: Deoxyribonucleic acid (DNA) is a polymer made up of two polynucleotide sequences which curl around…

Q: Which two of the following gene mutations would have the highest likelihood of causing a severe…

A: Introduction A mutation occurs when the sequence of DNA changes. Mutations can occur as a result of…

Q: Leber congenital amaurosis (LCA) is a form  of congenital blindness in humans and is  known to be…

A: Leber congenital amaurosis (LCA) is a form of congenital blindness in humans and is known to be…

Q: A nonsynonymous mutation is also referred to as missense mutation. Which of the following correctly…

A: Normal DNA contains a particular sequence of DNA. If the sequence of DNA is changed due to external…

Q: Same sense mutation is usually non-destructive due to the degeneracy of codons.    Group of answer…

A: Same sense Mutations are the point mutations that lead to form a different codon but it is…

Q: Cystic Fibrosis is a genetically heritable disease caused by the loss of the chloride channel, CFTR.…

A: Cystic fibrosis is a genetic disease that is characterized by the production of excessively thick…

Q: Which of the following arms of t-RNA is required for recognition of the t-RNA by its proper…

A:

Q: Is the mutation in the sickle cell gene a point mutation or a frameshift mutation?

A: Point mutations are a large category of mutations that describe a change in single nucleotide of…

Q: The Dscam locus in Drosophila melanogaster has 24 exons. Four of these exons are able to undergo…

A: Alternative splicing results in several products being made from one chromosome. In higher…

Q: Pick the most complete list of mRNA sequences that translate into Ser.   Question 3 options:…

A: According to the question, we have to find out the option which is the most complete list of mRNA…

Q: DNA mutations can affect the reading frame for the genetic code. What is a human condition caused by…

A: The cell is the basic structural and functional unit of the body. The nucleus is called the brain of…

Q: Mention four human genetic diseases that result from single gene mutation, please answer this…

A: Because of their uncomplicated inheritance patterns (recessive or dominant) and relatively simple…

Q: 11

A: Probably the earliest reference to age-related mental inadequacy is ascribed to Pythagoras in the 7P…

Q: The asterisk (*) in the diagram below indicates a single base mutation in the 5' splice site of the…

A: Splicing is one of the most important modifications which take place during mRNA maturation. There…

Q: A plant geneticist was examining the inversion mutation XI 501 in barley where a segment of DNA is…

A: Any alteration occurring in the DNA sequence of an organism is known as mutation.

Q: What are some limitations in the use of ASOs for exon-skipping therapies in Duchenne muscular…

A: Duchenne Muscular Dystrophy (DMD) is a muscular disease caused by mutations in the dystrophin gene…

Q: B-thalassemia is a hereditary blood disorder that leads to the formation of an abnormal hemoglobin…

A: Answer is  option A.

Q: Baby Y has been diagnosed with the Graham-Snavely mutation. This mutation produces a disorder with…

A: Transcription is the process that refers to the formation of mRNA (messenger ribonucleic acid) which…

Q: You are studying a mutation in mice, which acts dominantly. Mice that have only one copy of the…

A: Definition Mutations are changes in DNA sequence. it can result from DNA copying mistakes , made…

Q: You start by looking at the mutations that Yanofsky recovered in TrpA. One of these mutations…

A: Hi! Thank you for the question. As you have posted a question with multiple subparts, I will be…

Q: he solution to question 13 of Chapter 11 in the Human Heredity textbook says an insertion of 3…

A: An inherited change in genetic information is called a mutation. It is a sudden change. The mutation…

Q: The genetic alteration responsible for sickle-cell anemia in humans involves: a transition mutation…

A: sickle cell anaemia is caused by inherited abnormal hemoglobin that causes the sickling of red blood…

Q: disease caused by an error in the nucleotide excision repair process that fixes damage to DNA by…

A:

Q: The following is the only intron sequence of a gene that will be excised during the maturation of…

A: Prokaryotes have simpler cellular organization and gene structure when compared to eukaryotes.…

Q: The human PAH gene encodes the enzyme phenylalanine hydroxylase. Deficiency of this enzyme activity…

A: Genetic disease is caused due to mutation in the gene that may result in malfunction of the gene…

Q: Albinism is a condition where individuals can't make melanin pigment. The affected gene encodes for…

A: Albinism is a group of inherited disorders which can lead to no production of melanin pigment due to…

Q: A strain of Arabidopsis thaliana possesses a mutation in the APETALA2 gene. As a result of this…

A: Ribonucleic acid (RNA) is a biomolecule that plays important role in coding, decoding, and…

Q: Given the following MRNA sequence, what is the amino acid sequence of the polypeptide that will be…

A: The mRNA is read in the 5' to 3' direction by the transcription machinery to produce the polypeptide…

Q: Ochre and amber are two distinct nonsense mutations. Before the genetic code was worked out, Sydney…

A: The nucleotides in RNA (ribonucleic acid) or DNA (deoxyribonucleic acid) sequence are read as…

Q: If we have the following mutations, find the type of the mutation (silent or missense or nonsense?)…

A: In gametes, germline mutations occur. Some body cells may also be affected by somatic…

Q: For the given mutation below,please write down the reverse mutation and any intragenic suppressor…

A: Reverse mutation It is the mutation which denotes the mutational process that restores the wild type…

Q: A researcher studying late-onset Alzheimer's disease is interested in a gene, called ApoE, that…

A: Few important points should be kept : As we know non coding DNA is found within the most eukaryotic…

Q: A gene contains the sequence CGCATACGGTAC that results in the amino acid sequence arg-ile-arq- tyr.…

A: The DNA (deoxyribonucleic acid) codes for the peptide chain via transcription and translation. mRNA…

Q: Consider the following mutation, Allele #4 in a cell, which of the following are possible for the…

A: Transcription is the process that consists of several steps of DNA-based gene expression. Here a…

Q: For the following mRNA sequences, what is the amino acid sequence formed? Consult genetic code table…

A: We are provided the mRNA sequence, and we need to write the amino acid sequence formed.

Q: You have a patient in your clinic presenting symptoms of cystic fibrosis. You screen their CFTR gene…

A: Cystic fibrosis is a disease in which there is  excess mucus productions in the body such as lungs…

Q: CUGCUGUGCAGAUGCUGGACG

A: A missense mutation occurs when there is a mistake in the DNA code and one of the DNA base pairs is…

Q: Which of the following is likely associated with the mRNA processing step of alternative splicing?

A: A process that helps a single gene to code for many proteins is known as alternate splicing. It is…

Q: One of these mutations affected amino acid number 177 and changed it from Leucine to Arginine –…

A: DNA and RNA are polynucleotides, i.e., they are polymers of nucleotides. DNA stores genetic…

Q: Introns are commonly found in eukaryotic genes, but there are rare exceptions without introns,…

A: Introduction  DNA and RNA are the main genetic material found in all the species irrespective of…

Q: Given the following mRNA sequence: 5' GCCCAUGUGGCGCGAGUGAUUUAA 3' 1) Use the genetic code table…

A: Introduction The central dogma of molecular biology describes the flow of genetic information from…

Q: Hemophilia in the royal family was caused by the presence of a mutation in the gene for factor IX…

A: Inheritance or heredity is passing-on one trait form the parents to the progeny by either asexual or…

Q: The gene for Receptor Z contains an unknown number of untranslated first exons that are spliced to a…

A: * Given that the gene for receptor Z contains unknown number of untranslated first exons that are…

Mitochondrial Mutations

A mitochondrion is a cellular organelle that serves as the site for cellular respiration and energy production (ATP or Adenosine Triphosphate). It is a double-membrane-bound organelle and is only present in eukaryotic cells.