A researcher studying late-onset Alzheimer's disease is interested in a gene, called ApoE, that codes for a neuronal protein with many different variants. The boxes in this diagram represent the ApoE coding sequence. The ATG start codon is located in exon 1. The lines between exons represent introns. Which of the following alternative mRNA splicing events would likely result in the production of a functional protein variant? Exon 1 Exon 2 Exon 3 Exon 4 5' UTR 3' UTR 3' UTR Removal of Exon 4 only Removal of any one Exon Removal of either Exon 3 or Exon 4 but not both Removal of Exon 3 only Removal of Exon 1 only

A researcher studying late-onset Alzheimer's disease is interested in a gene, called ApoE, that codes for a neuronal protein with many different variants. The boxes in this diagram represent the ApoE coding sequence. The ATG start codon is located in exon 1. The lines between exons represent introns. Which of the following alternative mRNA splicing events would likely result in the production of a functional protein variant? Exon 1 Exon 2 Exon 3 Exon 4 5' UTR 3' UTR 3' UTR Removal of Exon 4 only Removal of any one Exon Removal of either Exon 3 or Exon 4 but not both Removal of Exon 3 only Removal of Exon 1 only

Name: 11 A researcher studying late-onset Alzheimer's disease is interested
Uploaded: 2024-03-20T06:42:55.000Z
Channel: Bartleby
Description: 11 A researcher studying late-onset Alzheimer's disease is interested in a gene, called ApoE, that codes for a neuronal protein with many different variants. The boxes in thisdiagram represent the ApoE coding sequence. The ATG start codon is located

Biology 2e

2nd Edition

ISBN:9781947172517

Author:Matthew Douglas, Jung Choi, Mary Ann Clark

Publisher:Matthew Douglas, Jung Choi, Mary Ann Clark

Chapter16: Gene Expression

Section: Chapter Questions

Problem 18RQ: IS. Alternative splicing has been estimated to occur in more than 95% of multi-exon genes. Which of...

See similar textbooks

Similar questions

Which of the following is/are typically removed from pre-mRNA during nuclear processing in eukaryotes? (a) upstream leader sequences (b) poly-A tail (c) introns (d) exons (e) all the preceding
A certain mRNA strand has the following nucleotide sequence: 5AUGACGUAUAACUUU3 What is the anticodon for each codon? What is the amino acid sequence of the polypeptide? (Use Figure 13-5 to help answer this question.) Figure 13-5 The genetic code The genetic code specifies all possible combinations of the three bases that compose codons in mRNA. Of the 64 possible codons, 61 specify amino acids (see Figure 3-17 for an explanation of abbreviations). The codon AUG specifies the amino acid methionine and also signals the ribosome to initiate translation (start). Three codonsUAA, UGA, and UAGdo not specify amino acids; they terminate polypeptide synthesis (stop).
If the coding region of a gene (the exons) contains 2,100 base pairs of DNA, would a missense mutation cause a protein to be shorter, longer, or the same length as the normal 700 amino acid proteins? What would be the effect of a nonsense mutation? A sense mutation?
The following is as segment of mRNA: 5'-UCGGAAUGUGGUGGCAUACAGGCUUACAGAACUAAGUCUGAGAAU-3' A. How many amino acids long will be the protein translated from the only reading frame available in this segment? B. If a mutation changes the third letter of the stop codon in the only reading frame available in this segment, how many amino acids long will be the protein translated?
The following is the only intron sequence of a gene that will be excised during the maturation of the mRNA. But it is not spliced in some tissues, where alternative splicing pattern is seen. Will the amino acid of its protein product following this sequence change? Explain with an example. ATGATAGCCAGACTCGCA
As shown in the following diagram, a pre-mRNA contains seven exons, which are numbered in black, and six introns, which are numbered in green. A splicing repressor binds at the 3′ splice site at the end of intron 4, which is just before exon 5. What exons will be included in the mature mRNA?
The base sequence of the gene coding for a short polypeptide is TAC CTA CGC TAG GCG ATT GAC T. What would be the base sequence of the mRNA transcribed from this gene? The base sequence of the gene coding for a short polypeptide is TAC CTA CGC TAG GCG ATT GAC T. From your answer to the last question, answer this Using the genetic code, give the amino acid sequence of the polypeptide translated from this mRNA. Use the three-letter abbrebviation of the amino acid and start with the start codon and stop in the stop codon.
What will be the overall anti-codon sequence in tRNA for this mRNA? 5’-GUAGCCUUAUCUAGCGAUCACCGUCCGUAUUACUAGUGGCCAGACUCUUUUCACCAUGUAUAGUUG-3’
A eukaryotic structural gene has two introns and three exons : 5prime end exon1 intron1 exon2 intron2 exon3 3 prime end The GU at the 5’ end of intron2 has been mutated so it is no longer recognized What would the mature mRNA look like in the wild type and in the mutant? 1-wild type? 2-mutant type?
The amino acids, in one-letter symbols and no spaces, coded by the following mRNA sequence is 5’ AAUGGAACGUCGGUACUGCCAUCGCAUUAGUACCAUGGCAAGCUGAAGC 3’
Which of the followings indicate the order of procaryotic mRNA degreadation? cleavage of the triphosphate 5′ terminus to yield a monophosphate- 3′ to 5′exonuclease digestion- The endonucleolytic cleavages occur in a 5′ to 3′ direction on the mRNA following the passage of the last ribosme cleavage of the triphosphate 5′ terminus to yield a monophosphate- The endonucleolytic cleavages occur in a 5′ to 3′ direction on the mRNA following the passage of the last ribosme- 3′ to 5′exonuclease digestion The endonucleolytic cleavages occur in a 5′ to 3′ direction on the mRNA following the passage of the last ribosme- cleavage of the triphosphate 5′ terminus to yield a monophosphate- 3′ to 5′exonuclease digestion
In eukaryotic organisms, pre-mRNA transcripts are formed and need to be modified in order to create the mature mRNA destined for translation. Which of the following indicate modifications that occur as part of this process? a. The pre-mRNA is spliced to produce multiple mature mRNAs b. A 3' poly-A tail is attached to the mature mRNA c. A 5' cap is attached to the mature mRNA d. All of the above are ways in which the pre-mRNA is modified to create the mature mRNA e. None of the above are ways in which the pre-mRNA is modified to create the mature mRNA