Q: Exons 1, 2 and 3 of a human gene are 156, 224 and 524 bp long respectively. The introns 1 and 2 are…
A: Introduction :- Exons are the coding regions of an RNA transcript or the DNA that codes for it that…
Q: Eukaryotic messenger RNA can undergo post synthetic processing after transcription and before…
A: The transcription is the process by which RNA is produced from DNA. In case of eukaryotic mRNA, it…
Q: Consider this list (below) of steps involved in transcription. These steps are out of order.…
A: Replication, transcription, and translation are used by all cells to keep track of their genetic…
Q: Alternative splicing a. increases the number of proteins made from one gene b. increases the number…
A: in alternative splicing there is a selection of different types of sites of splicing which can…
Q: Alternative splicing takes place in more than 95% of the human protein-encoding genes with multiple…
A: In alternative splicing, a single pre-mRNA may be spliced in two or even more ways depending upon…
Q: What type of genetic regulation seems to be the most similar between prokaryotes and eukaryotes?…
A: Genetic regulation is defined as the process of switching genes "ON" and "OFF" to see in a cell's…
Q: Bacteria use the same stop codons as eukaryotes. However, bacterial transcription is also terminated…
A: The transcription in prokaryotes is either terminated by rho-dependent or rho-independent process or…
Q: Which of the following best explains how the expression of a eukaryotic gene encoding a protein will…
A: The central dogma is common throughout the life forms on earth: i.e. DNA to RNA to Protein. Having…
Q: Draw the SMN2 pre-mRNA (10 exons and 9 introns), indicate the 5’ and 3’ SS location. Draw the SMN2…
A: Proteins are obtained from DNA that contains the required genetic information. DNA is first…
Q: Which of the following is/are a role for the poly-A tail? (Select all that apply.) a) Facilitates…
A: Polyadenylation is a post-transcriptional modification process where the PolyA tail containing…
Q: The gene ABCD is 1500 bases long What would be the likely length of the pre-mRNA molecule? ____ What…
A: INTRODUCTION Exons are coding sections of an RNA transcript, or the DNA encoding it, that are…
Q: a) Two of the following three mRNA sequences code for the same protein. Delete the sequence which…
A: Translation is defined as the process where the nucleotide sequence in the mRNA is translated to…
Q: In forming the lariat structure during splicing which of the following attaches to the branch point…
A: A defining feature of this process is the creation of 2' -5' phosphodiester linkage at an adenosine…
Q: Introns are intervening sequences; what are exons?
A: A gene is an essential unit of heredity and a sequence of nucleotides in DNA or RNA that encodes the…
Q: In Figure 8-15, what do you think would be the effect of a A to G mutation in the branch point…
A: When the nucleotides sequences in the genome of an organism are altered or changed due to mistakes…
Q: Which of the following makes alternative RNA splicing possible? Group of answer choices A. Parts of…
A: Option A
Q: Which of the following statements about pre-mRNA splicing is FALSE? a. Splicing of an intron…
A: RNA splicing is a kind of RNA processing in which a newly formed pre-mRNA transcript is transformed…
Q: Which of the following is TRUE about MRNA splicing? O a. Splicing occurs after complete mRNA is…
A:
Q: Which of the followings best describes the histone mRNA structure? histone mRNAs end in a…
A: A histone is a protein that provides structural support to a chromosome. In order for very long DNA…
Q: Which of the following statements regarding splicing in eukaryotes is correct?a) Several reactions…
A: DNA is the genetic material that carries genetic material in the form of coded nucleotide sequences.…
Q: Which of the following statements about the attempt to express a eukaryotic gene in bacteria is…
A: The regulation of gene expression in eukaryotes occurs at several level, which is far more diverse…
Q: After transcription has been completed in eukaryotes, the mRNA molecule first goes through some…
A: Nucleus is main controller of the cell which carries genetic instructions . It contain thread like…
Q: Once transcribed, the length of the mRNA for gene X is usually 1000 nucleotides long in your…
A: Rho utilization site , also known by the acronym rut is a sequence of RNA in bacteria upstream of…
Q: When a eukaryotic gene is cut out of genomic DNA, geneticists have discovered that enabling the…
A: A gene is sequence of DNA, which codes for an mRNA through transcription. During the replication…
Q: Which of the following is NOT a true statement about the 5' cap? O A. The Cap Binding Complex (CBC)…
A: The five-prime cap (5′ cap) is a specially altered nucleotide on the 5' end of some primary…
Q: Which of the following could not affect splicing? A. Mutation that changed the sequence of a…
A: The basis of inheritance is the information passed down from parent to offspring. The replication of…
Q: After an MRNA primary transcript is created, a modified guanine nucleoside triphosphate is added to…
A: The genetic information in a cell is processed in a series of steps namely replication,…
Q: Consider the following mRNA base sequence 5' CUU CAG 3 a What dipeptide is coded for this mRNA?…
A: Genetic codes are unambiguous that means one codon will code for only one amino acid. Codons are…
Q: Alternative splicing can occur when a cell-specific protein binds to a transcript, blocking a splice…
A: A gene is a functioning heredity unit made up of DNA that provides instructions for the creation of…
Q: man rhodopsin gene is 2675 nucleotides long from transcription start site to transcription stop…
A: The rho factor provides directions for creating a macromolecule referred to as rhodopsin. This…
Q: explain which sequences within the pre-mRNA determine where splicing occurs? How? Why?
A: Splicing of a pre-mRNA molecule occurs in several steps that are catalyzed by small nuclear…
Q: Nascent form of the mRNA A. undergoes splicing only after capping B. is also called hnRNA C. is…
A: A. undergoes splicing only after capping B. is also called hnRNA D. participates in the spliceosome…
Q: The diagram shows a pre-MRNA before splicing and processing. In this cell type, a protein is present…
A: RNA-Splicing: In molecular biology, RNA splicing is the process by which a newly synthesised…
Q: In eukaryotes, why is the initial RNA transcript usually longer than the mature mRNA molecule?…
A: Transcription is the process by which messenger rna is made from DNA. This process takes place…
Q: Below is an mRNA molecule in its wild type form. 5’ CCGUACAUGGUGAAAAGUCAAUGACCAAA 3’ An…
A:
Q: Which modification of eukaryotic mRNA is likely absent if the mRNA can leave the nucleus but cannot…
A: mRNAs are formed in the form of primary transcripts.
Q: the processing of pre-mRNA in eukaryotes Select one: a. Exons are joined together using…
A: In Prokaryotes; both Transcription and translation process takes place in the cytoplasm; but in…
Q: Which of the following would not be the consequence of alternative splicing? Two genes to express…
A: Alternative splicing is the method of producing differentially spliced mRNAs by choosing alternative…
Q: Sequences in the beginning and end of a typical human intron are: GU and AG GG and AG UA and UA…
A: RNA splicing is a form of RNA processing in which a newly made precursor messenger RNA transcript is…
Q: Shown below is a schematic drawing of a gene, with the transcription unit divided into numbered…
A: Transcription is the process which are answerable for integrating the RNA from the DNA by the…
Q: A mutation has occurred to a wild type mRNA sequence: Wild Type: 5’-AUG-UUG-CAA-GCG-3’ The new…
A: A mutation is a change in the nucleotide sequence of the DNA of an organism. Mutations can be caused…
Q: With regard to RNA polymerase proofreading ability, which of the following is true? OA 3'5'…
A: Answer : with regard to rna polymerase proof reading, the true statement is : no proofreading…
Q: A eukaryotic protein-encoding gene contains two introns and three exons: exon 1–intron 1–exon…
A: Splicing is a process of removal of non-coding sequences and the joining of coding sequences. The…
Q: Which one of the following options is NOT a step in RNA processing? Addition of the 5’ G cap…
A: Inside the cells of any organism, RNA is considered an essential biomolecule as it performs a…
Q: Based on the electron micrograph shown, which of the following statements is/are correct/true?…
A: Introduction :- Microorganisms, cells, big molecules, biopsy samples, metals, and crystals are among…
Q: For each of these things, say whether it describes the coding sequence or the regulatory sequence.…
A: Coding sequences are sequences or portions of a gene or mRNA which codes for a protein. The coding…
Q: How would the removal of the TATA box in a eukaryotic gene impact transcription? Group of answer…
A: A gene is the stretch of DNA that codes for a polypeptide.
Q: Which of the following is an example of chromatin modification that stimulates gene expression?…
A: Chromatin is basically the thread like structure that is present in the nucleus during the non…
Q: Draw the SMN2 mature mRNA before treatment with Spinraza
A: To better understand let's revise that the DNA is the hereditary molecule that transfers genetic…
A process that helps a single gene to code for many proteins is known as alternate splicing. It is also known as alternate RNA (ribonucleic acid) splicing or differential splicing. Alternate splicing takes place during the gene expression. The proteins derived from alternate splicing of mRNA contain differences in their sequence of amino acids.
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- The pre-mRNA transcript and protein made by several mutant genes were examined. The results are given below. Determine where in the gene a likely mutation lies: the promoter region, exon, intron, cap on mRNA, or ribosome binding site. a. normal-length transcript, normal-length nonfunctional protein b. normal-length transcript, no protein made c. normal-length transcript, normal-length mRNA, short nonfunctional protein d. normal-length transcript, longer mRNA, shorter nonfunctional protein e. transcript never madeThe asterisk (*) in the diagram below indicates a single base mutation in the 5' splice site of the second intron of a eukaryotic gene. Due to this mutation, the second intron is now not ‘spliced out’ during the splicing process. What are the most likely consequences of this mutation with respect to the size of the pre-mRNA and the size of the mature mRNA? a. The pre-mRNA will be longer and the mature mRNA will be longer. b. The pre-mRNA will be longer and the size of the mature mRNA will not be affected c. The size of the pre-mRNA will not be affected and the mature mRNA will be longer d. The size of the pre-mRNA will not be affected and the size of the mature mRNA will not be affectedWhich of the followings indicate the order of procaryotic mRNA degreadation? cleavage of the triphosphate 5′ terminus to yield a monophosphate- 3′ to 5′exonuclease digestion- The endonucleolytic cleavages occur in a 5′ to 3′ direction on the mRNA following the passage of the last ribosme cleavage of the triphosphate 5′ terminus to yield a monophosphate- The endonucleolytic cleavages occur in a 5′ to 3′ direction on the mRNA following the passage of the last ribosme- 3′ to 5′exonuclease digestion The endonucleolytic cleavages occur in a 5′ to 3′ direction on the mRNA following the passage of the last ribosme- cleavage of the triphosphate 5′ terminus to yield a monophosphate- 3′ to 5′exonuclease digestion
- Which of the following statements about pre-mRNA splicing is FALSE? a. Splicing of an intron requires consensus sequences at the splice donor, the splice acceptor and the branch point of the intron. b. The spliceosome contains proteins and RNA molecules. c. Some snRNAs base pair with splice consensus sequences on the primary transcript. d. Splicing happens before the export of the mRNA to the cytoplasm. e. Splicing happens in the cytoplasm, when spliceosomes move down the pre-mRNA in front of ribosomes.Which of the following could not affect splicing? A. Mutation that changed the sequence of a splicing enhancer B. No binding of Cap Binding Complex to the 5’ cap of a pre-mRNA C. Expression of a miRNA that targeted mRNA encoding splicing recognition factors D. Blocking the ability of splicing recognition factors to recruit spliceosomes E. None of the above (all could affect splicing)As shown in the following diagram, a pre-mRNA contains seven exons, which are numbered in black, and six introns, which are numbered in green. A splicing repressor binds at the 3′ splice site at the end of intron 4, which is just before exon 5. What exons will be included in the mature mRNA?
- "The gene for Receptor Z contains an unknown number of untranslated first exons that are spliced to a common exon 2" - what does it mean if a "first exon" is "spliced to a common exon 2"? Does it mean that Exon 1 is attached to Exon 2, but Exon 1 is not part of the translated protein - similar to the below schematic? mRNA Option 1: [Exon 1a][Exon 2][Exon 3].... mRNA Option 2:[Exon1b][Exon2][Exon 3] mRNA Option 3: [Exon1c][Exon2][Exon 3]A eukaryotic structural gene has two introns and three exons : 5prime end exon1 intron1 exon2 intron2 exon3 3 prime end The GU at the 5’ end of intron2 has been mutated so it is no longer recognized What would the mature mRNA look like in the wild type and in the mutant? 1-wild type? 2-mutant type?The human rhodopsin gene is 2675 nucleotides long from transcription start site to transcription stop site. The human rhodopsin protein is 348 amino acids. What is the length of the mature mRNA (starting at the start codon and ending at the stop codon) from which the rhodopsin protein is synthesized? Explain how you reached your answer, including information about introns, exons, and splicing.
- The following is the only intron sequence of a gene that will be excised during the maturation of the mRNA. But it is not spliced in some tissues, where alternative splicing pattern is seen. Will the amino acid of its protein product following this sequence change? Explain with an example. ATGATAGCCAGACTCGCAIn eukaryotic organisms, pre-mRNA transcripts are formed and need to be modified in order to create the mature mRNA destined for translation. Which of the following indicate modifications that occur as part of this process? a. The pre-mRNA is spliced to produce multiple mature mRNAs b. A 3' poly-A tail is attached to the mature mRNA c. A 5' cap is attached to the mature mRNA d. All of the above are ways in which the pre-mRNA is modified to create the mature mRNA e. None of the above are ways in which the pre-mRNA is modified to create the mature mRNAWhich of the following is NOT a DIFFERENCE between prokaryotic and eukaryotic gene regulation? A. prokaryotic mRNA is NOT capped by a 5’mG after transcription, but eukaryotic mRNA is so capped B. eukaryotic mRNAs are monocistronic (encode single proteins), whereas prokaryotic mRNAs are polycistronic (encode multiple proteins) C. prokaryotic mRNA is not modified by polyadenylation after transcription, but eukaryotic mRNA is so modified. D. translation of eukaryotic mRNA into protein is not coupled to transcription of the mRNA from DNA, but in prokaryotes it is so coupled E. prokaryotic translation and eukaryotic translation use different genetic codes to translate mRNA codons into amino acid sequences of proteins
