In a study, melanoma patients who developed vitiligo, lived longer than those who did not. The explanation for this is melanin synthesis in vitiligo patients was suppressed due to medications for melanoma patients with vitiligo already had an autoimmune disease before getting melanoma vitiligo was an indicator of a robust immune response to melanoma presence of vitiligo was an observation unrelated to melanoma   Cells undergoing EMT are most frequently observed In normal tissue surrounding a tumor. In the center of a tumor. Near the edge of a tumor. Only in circulating tumor cells.

Q: Proteins/peptides exclusively expressed by tumor cells are termed as                  a. tumor…

A: Cancers are caused by mutations in the gene sequence of the tumor suppressor gene or protooncogene…

Q: Malaria (a) is transmitted by the bite of a female tsetse fly (b) is caused by a parasitic…

A: Malaria is a disease characterized by fever with chills and fatigue.

Q: Choose an organism (plant or animal) and write its common name on the line below. Write the…

A: The earth's biosphere consists of many animals and plants and studying them individually is a…

Q: A.name four aspergillus species B. give macroscopic description of them

A: Aspergillus niger  Microscopic characters :  Cottony appearance  Initially white  and ren becone…

Q: d) Identify a passive tissue that could be exposed to continued plastic stress (deformation).…

A: In mechanics, muscles have two primary properties: passive and active. When the muscle is extended…

Q: Proteus vulgaris is positive for the production of the enzyme phenylalanine whereas Escherichia coli…

A: INTRODUCTION Proteus vulgaris is a Gram-negative, rod-shaped, nitrate-reducing, indole-positive, and…

Q: Effects of temperature and enzymes on free energy and activation energy Use the graph to determine…

A: Enzymes Biological catalysts of the chemical reactions. They are neither consumed nor permanently…

Q: Compare and contrast GPCR and RTK signaling. What role does GTP play in each? What role does…

A: Receptors are composed of proteins. These involve in cell signaling process.Two types of receptors…

Q: Strain X. spp. is a rod-shaped, anaerobic, Gram-positive bacterium with peritrichous flagella and…

A: Doubling time is the time required by a cell, in this case the bacterial cell, to divide and produce…

Q: Put the following in order of their evolution. invertebrates→algae→amphibians→birds-reptiles→mammals…

A: Evolution is the long process by which living organisms changes over time through changes in their…

Q: What do coral cores show us??

A: Introduction Corals are marine invertebrates that belong to the phylum Cnidaria's class Anthozoa.…

Q: Explain why the yield of ATP is high in oxidative phosphorylation as compared to other stages.

A: Answer :- Adenosine 5′-triphosphate, abbreviated as ATP and generally written without the 5′-, is a…

Q: Which of these statements about taste is true? All bitter-tasting compounds have a similar chemical…

A: Taste buds are peripheral organs of gustation that are primarily found in the tongue epithelium but…

Q: Which is NOT a modification made to pre-mRNA? addition of a 5' cap removal of introns addition of a…

A: In bacteria, RNA transcripts are ready to act as messenger RNAs and get translated into proteins…

Q: Below is a Figure from a Shoot Tip, indicate which numbers islare meristematic cells? - 2 3

A:

Q: Cytosine makes up 42% of the nucleotides in a sample of DNA from an organism. The composition of the…

A: Introduction :- Cytosine, along with adenine, guanine, and thymine, is one of the four nucleobases…

Q: D Question 19 What is the name of the enzyme responsible for removal of one glucosyl unit from the…

A: The enzyme which removes one glucosyl unit from non reducing end if glycogen is glycogen…

Q: Patients who are taking herbal remedies or dietary supplements do not need to list them on…

A: False...

Q: Match the following polymerases with their function. + DNA Polymerase III DNA polymerase I + RNA…

A:

Q: Explain two ways that soil can lose nutrients.

A: * The soil can lose its nutrients by soil erosion, runoff, leaching and burning of crop residues. *…

Q: sphingolipids

A: Plasmogens:  The plasmogen  is the chemical substance which is the  important living portion of…

Q: Carrying capacity is and is represented by the letter on the graph. O he maximum number of…

A: Population size  The population size of an ecosystem depends upon food, shelter, area, etc.

Q: Match the molecules (List 2) with the cell structures in which they are involved (List 1). A cell…

A: The cell is the structural and functional unit of life. It comprises of the cell membrane, cell…

Q: What is STD?  in 3 paragraphs (Introduction, Body and Conclusion)

A: Answer

Q: How is a child with Type I diabetes similar to a child who is starving? Mark all that apply 2 Both…

A: Type 1 diabetes is a chronic disease with elevated blood glucose levels, in this case, the pancreas…

Q: Which protein is NOT necessary to initiate DNA replication in E. coli? A. helicases

A: The biological process of making two identical DNA replicas from a single original DNA molecule is…

Q: In confocal microscopy, what is the theoretical resolving power of the objective used (63X, NA 1.3,…

A: Resolving power signifies the smallest distance between two separate points of an object, when…

Q: What is the DNA template for the RNA sequence 5' UAACGGAGCCUAAUC 3'? O 5' GAUUAGGCUCCGUUA 3' O 5'…

A: In reverse transcription, RNA is "reverse transcribed" into DNA. This process, catalyzed by reverse…

Q: 14. Why is titin important with respect to muscle contraction?

A: Introduction Titin:- It is a protein that in humans is encoded by the TTN gene, it is the largest…

Q: Match each vitamin with the correct deficiency or toxicity condition or symptoms Vitamin C [Choose]…

A:

Q: Match the molecules (List 2) with the cell structures in which they are involved (List 1). A cell…

A: ANSWER;- A) cadherin- desmosomes B) cellulose - cell wall C) collagen - basal lamina D) connexons -…

Q: In the beginning of the Surgery section, what is the “general” section? Do we use modifiers in the…

A: General surgery is a surgical speciality that focuses on abdominal contents such as the oesophagus,…

Q: Which of the following best describes the central dogma of molecular biology? O A) MRNA is…

A: Introduction In molecular biology, a central dogma is an illustration showing the flow of genetic…

Q: Why did Carl Woese propose the domain Archaea? The domain Bacteria already had too many organisms in…

A: Carl Woese propose the three domain classification. He propose that all cellular life is divided…

Q: || II IV ve is a pedigree for longer teeth. trait autosomal dominant or autosomal recessive? Explain…

A: Pedigree analysis helps us identifying the mode of inheritance of a particular disease by observing…

Q: Describe the ethical issues encompassing germ line gene therapy in 150 words.

A: Introduction Germline gene therapy:- In this therapy DNA is inserted into the reproductive cells…

Q: Which structure is involved in the transport of water through a vascular plant? xylem O phloem…

A: Introduction - Vascular plants, also known as tracheophytes or Tracheophyta, are a wide category of…

Q: To determine: Whether the compounds produced b insects that are similar to natural painkillers are a…

A: Referred pain is the sensation and feeling of pain in the body as if it occurred or was generated in…

Q: Why did Mendel self-pollinate the tall F1 plants to get the F2 generation and crossed a pure…

A: Introduction - The law of dominance, the law of segregation, and the law of independent assortment…

Q: Cystic Fibrosis is caused by a mutation in the CFTR gene, and an ideal form of treatment would be to…

A: Cystic fibrosis is an inherited life threatening disorder that causes severe damages to lungs,…

Q: b) Use the DNA sequence below to answer the following questions. 3'- TACGAACGAGTGCCCCAAAATT -5' What…

A: The process of converting DNA instructions into proteins is known as the central Dogma.

Q: Which of the following is NOT true of Aspergillosis? it is a zoonosis it may cause serious lung…

A: Aspergillosis is a fungal disease. Fungal diseases are caused by different causative agents.…

Q: In chymotrypsin the active site histidine Oa. Forms a tetrahedral intermediate O b. Acts as a proton…

A: Introduction Chymotrypsin is a digestive enzyme that belongs to the serine proteases superfamily. It…

Q: A. Identify the following _______________ 1. The hormone that stimulates the mammary gland to…

A: Introduction :- The mammary gland is a highly evolved and specialised organ that exists in pairs on…

Q: An allosteric activator or inhibitor O a. Competes with substrate for enzyme binding O b. Shifts the…

A: Given: Enzymes are the molecules that act as biocatalysts, aids biological and biochemical reactions…

Q: Root hairs increase the surface area of the root O increase water absorption increase nutrient…

A: Water and mineral nutrients move from the soil to the upper parts of the plants through the xylem.…

Q: Set 3: Mutagens 51) breaks the sugar-phosphate backbone of DNA A) ultraviolet light 52) cause…

A: 51. C. Ionising radiations 52.  E. Frameshift mutagens 53.  B- Nucleotide analog 54. A,. UV rays 55.…

Q: Explain the formation of tree rings.

A: Introduction :- A tree's girth grows each year, and the new growth is known as a tree ring. The…

Q: Consider the following sentence: "The dog did not eat." Which of the following variations of this…

A: Mutation is a random event. It is responsible for change the sequence of nucleotide in a gene.

Q: In order of progression, state the steps that would lead to the development of natural active…

A: Principle of Active Immunity: Humoral immunity is the mechanism by which your body develops…

Defense Mechanism

Circumstances influence and compel people to behave in a certain way. One such behavior is a defense mechanism. It is employed by people to escape from unpleasant circumstances, thoughts and actions. Defense mechanisms are, thus, psychological strategies that help to avert and avoid unwanted feelings such as guilt or shame and situations such as threat and danger.