Explain well. Asap Which protein is NOT necessary to initiateDNA replication in E. coli?А.helicasesВ..primasesC.topoisomerasesD..DNA-binding proteinsЕ.„All of them are necessary.B.

The biological process of making two identical DNA replicas from a single original DNA molecule is…

Answered: Which protein is NOT necessary to…

Science

Biology

Which protein is NOT necessary to initiate DNA replication in E. coli? A. helicases

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter11: Genome Alterations: Mutation And Epigenetics

Section: Chapter Questions

Problem 19QP: Our bodies are not defenseless against mutagens that alter our genomic DNA sequences. What...

See similar textbooks

Related questions

Q: Cytosine makes up 42% of the nucleotides in a sample of DNA from an organism. The composition of the…

A: Adenine, guanine, cytosine and thymine are the nucleotide bases of DNA that stores genetic…

Q: What do you mean by protandry? Give its advantages?

A: Introduction - When a creature begins its life as a man and later transforms into a female. The…

Q: In ecological systems, a rough rule of thumb is that when energyis transferred from plants to…

A: Food chains and food webs are the means of energy transfer in the ecosystem.

Q: 1. What do ascaris lumbricoides egg look like? 2. How can it infect a person? 3. How to prevent its…

Q: Referring to the figure, what bases will be added to the primer as DNA replication proceeds? 5'[a]3'…

A: In a DNA molecule, the bases on the opposite strands are paired complementary to each other. A…

Q: 29. Galloway Origin: Scotland one of the oldest British Breeds, the Galloway were first brought to…

A: There are varieties of breeds of cows and cattles that have their unique and distinct…

Q: QUESTION 4 Select all the statements that correctly describe triglycerides. Sources: textbook…

A: Answer

Q: Explain the steps involved in translocation of sucrose.

A: Xylem and phloem are the vascular tissues present in the vascular plants.

Q: sphingolipids

A: Plasmogens: The plasmogen is the chemical substance which is the important living portion of…

Q: You are counting white blood cells in a freshly drawn blood sample. You dilute the blood 1/20 in 5%…

A: The answer is option D.8.7×10 power 6.

Q: sabuoraud slope culture contains a black mould. describe a diagnostic method you can use to identify…

A: Answer :: The Donas do Sabor Festival, a delightful tour of Salvador's kitchens run by women, has…

Q: d) Identify a passive tissue that could be exposed to continued plastic stress (deformation).…

A: The tissues that undergoes stretching without even stimulation is referred as the passive tissue.…

Q: How do protists vary in their means of obtaining nutrients?

A: Introduction :- Algae, amoebas, euglena, plasmodium, and slime moulds are examples of protists.…

Q: What effect does the agricultural industry have on climate change?

A: Agriculture: Agriculture, sometimes known as farming, is the cultivation of plants and cattle.…

Q: Explain why the yield of ATP is high in oxidative phosphorylation as compared to other stages.

A: Answer :- Adenosine 5′-triphosphate, abbreviated as ATP and generally written without the 5′-, is a…

Q: d) Identify a passive tissue that could be exposed to continued plastic stress (deformation).…

A: In mechanics, muscles have two primary properties: passive and active. When the muscle is extended…

Q: cribe in detail the mechanism of action of memantine in the treatment of Alzheimer’s Disease.

A: Alzheimer's disease is defined as a medical condition in which an individual finds it difficult to…

Q: Which of these statements about taste is true? All bitter-tasting compounds have a similar chemical…

A: Taste buds are peripheral organs of gustation that are primarily found in the tongue epithelium but…

Q: 6.3.7 Activity 6.1 2 List and briefly explain four methods of studying an E-S complex. ngenic…

A: Answer :- 1) There are various methods of studying the Enzyme-substrate complex like magnetic…

Q: What are differences in which CMV & the ssRNA bacteriophages protect their genomes within the host…

A: To explain: To explain the differences in which cucumber mosaic virus and the ssRNA bacteriophages…

Q: O c) Frameshift mutation

Q: If you were to remove the ER retrieval signal fromprotein disulfide isomerase (PDI), which is…

A: We got the information of first type in carboxyl terminus of soluble ER proteins and in golgi…

Q: Make a situation on how an organism (plant/animal) maintains homeostasis.

A: Homeostasis It is defined as the ability of the organism to maintain a constant and stable internal…

Q: List some differences between eudicots and monocots

A: Introduction :- The term eudicots, also known as tricolpates, refers to real dicots, which are…

Q: Which are with Helper T-cells

A: Helper T-cells is a type of immune cell that stimulates killer T cells, macrophages, and B cells to…

Q: Below is a Figure of an Onion Root Tip, determine which of the encircled is/are meristematic?

A: Among the encircled regions the region 1 is representing the root apical meristem.

Q: In a nucleosome, the DNA is wrapped around ribosomes a thymine dimer polymerase molecules histones

A: Nucleosome Nucleosome is a segment of DNA that wrapped around a protein core.

Q: Is the plant with the yellow flower above a eudicot or a monocot? What about the plant with the…

A: * The plant with yellow flower is comes under eudicot. * This yellow flower bearing plant is called…

Q: he ability to multiplex the PCR reactions used in STR analysis (many PCR amplifications occurring in…

A: Dr.Kary Mullis invented the polymerase chain reaction (PCR) in 1983. The enzyme used in this…

Q: The following images show a pure culture that has been grown on a brewers agar deep, tested for the…

A: Various biochemical tests are performed to differentiate bacteria.

Q: Explain the total yield of ATP from aerobic respiration in three different stages of cellular…

A: The three stages of cellular respiration are - 1) Glycolysis - It is a step of breaking down 1…

Q: Explain two ways that soil can lose nutrients.

A: * The soil can lose its nutrients by soil erosion, runoff, leaching and burning of crop residues. *…

Q: Hamilton's Rule describes the relationship between cost and relationship in the evolution of…

A: Hamilton's rule states that a trait is naturally selected if the benefit to others, B, multiplied by…

Q: Derive an explanation of a human genetic disorder.

A: A genetic disorder the kind of disorder that is due to the mutation in a single gene. Mutations are…

Q: Match each item with the correct statement below. Nonpharmacologic methods to manage…

A: Introduction :- Both Crohn's disease and ulcerative colitis are inflammatory bowel diseases. Crohn's…

Q: ori Clo fcoR v OFP Below is the plasmid map of pGLO which contains the Green Fluorescent Protein…

A: pGLO: pGLO is an engineered plasmid that contains genes for beta- Lactamase. Beta-lactamase…

Q: How is a child with Type I diabetes similar to a child who is starving? Mark all that apply 2 Both…

A: Type 1 diabetes, also known as insulin-dependent diabetes, is a chronic condition in which the…

Q: Which are considered Zoonotic diseases? Select all that apply. O Ebola O HIV O Rabies Hantavirus…

A: Disease is a kind of harmful condition which disturb or impairs functioning of body part or whole…

Q: Compare Chlamydia and HPV infections in females. Discuss why one of these two conditions is more…

A: Chlamydia and HPV infections are most prevalent sexually transmitted infections which are spread by…

Q: How many ATP molecules would be generated if an 8-carbon fatty acid were metabolized solely by the…

A: Triacylglycerols are cleaned to fatty acids and glycerols by lipases before they are used for…

Q: Assume you want to make and study fragments of a protein. Would you expect that any fragment of the…

A: Proteins are the polymers of amino acids.

Q: phylogenetic tree according the the island: 1) Anolis sheplani 2) Anolis cybotes 3) Anolis olssoni…

A: Phylogenetic tree A phylogenetic tree is an evolutionary tree that depicts the evolutionary…

Q: Oestrogen, follicle-stimulating hormone (FSH) and luteinising hormone (LH) works together to…

A: The endocrine system collaborates with the neurological system to keep the body in a state of…

Q: Choose a situation on how an organism (plant/animal) maintains homeostasis.

A: The term homeostasis was given by Canon (1960). It is the mechanism by which stable chemical and…

Q: Why is glucose provided by glycogenolysis in the liver but not in skeletal muscle?

A: Through glycogenolysis process, glycogen broken down into glucose and provide energy. Muscle…

Q: To explain: Why do seedlings that germinate in a fully darkened room grow taller than seedlings of…

A: Every living thing is hardwired to thrive in its own environment. Nonetheless, they require a number…

Q: Pathopysiology for imperforated anus

A: Introduction Pathophysiology:- It is a deranged function in an individual or an organ due to…

Q: "hat is the function of e these functions sin re

A: A flower is a reproductive structure found in flowering plants. It is also known as a bloom or…

Q: DNA is composed of .which are attached to each other by bonds. O A) nucleotides. phosphodiester O B)…

A: DNA or Deoxyribonucleic acid is the genetic material in humans. It was discovered as a double helix…

Q: Termites digest wood with the help of an enzyme secreted by the- (A) Salivary glands (B) Cells in…

A: Termites are insects that feed on wood. They get nutrients from cellulose found in wood.

Concept explainers

Immune Disorders

The collaboration between the cells and proteins that work together as a defense system against infection comprises the immune system.Each of them performs a variety of tasks to recognize and/or react against a foreign body.

Question

100%

Explain well. Asap

Which protein is NOT necessary to initiate
DNA replication in E. coli?
А.
helicases
В.
.primases
C.
topoisomerases
D.
.DNA-binding proteins
Е.
„All of them are necessary.
B.

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Introduction

VIEW

Explanation

VIEW

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

In a bacterial culture in which all cells are unable to synthesizeleucine (leu-), a potent mutagen is added, and the cells areallowed to undergo one round of replication. At that point, samplesare taken, a series of dilutions are made, and the cells areplated on either minimal medium or minimal medium containingleucine. The first culture condition (minimal medium) allowsthe growth of only leu+ cells, while the second culture condition(minimal medium with leucine added) allows growth of all cells.The results of the experiment are as follows: Culture Condition Dilution ColoniesMinimal medium 10-1 18Minimal medium + leucine 10-7 6What is the rate of mutation at the locus associated with leucinebiosynthesis?
Several temperature-sensitive mutant strains of E. coli displaythe following characteristics. Predict what enzyme or functionis being affected by each mutation.(a) Newly synthesized DNA contains many mismatchedbase pairs.(b) Okazaki fragments accumulate, and DNA synthesis is nevercompleted.(c) No initiation occurs.(d) Synthesis is very slow.(e) Supercoiled strands remain after replication, which isnever completed.
Describe an experimental approach to determining the processivity of a DNA polymerase (i.e., the number of nucleotides incorporated per chain per polymerase binding event).
. In two isolates (one is resistant to ampicillin and theother is sensitive to ampicillin) of a new bacterium,you found that genes encoding ampicillin resistanceare being transferred into the sensitive strain. . To determine if the gene transfer is transformationor transduction, you treat the mixed culture of cellswith DNase. Why would this treatment distinguishbetween these two modes of gene transfer? Describethe results predicted if the gene transfer is transformation versus transduction
Which steps in the double-strand break model for recombinationwould be inhibited if the following proteins were missing? Explainthe function of each protein required for the step that is inhibited.A. RecBCDB. RecAC. RecGD. RuvABC
Define the following terms:a. processivityb. replisomec. exonucleased. DNA ligasee. replication fork
Polymerases usually add only about 10 nucleotides toa DNA strand before dissociating. However, during replication, DNA pol III can add tens of thousands ofnucleotides at a moving fork. How is this additionaccomplished?
After several rounds of replication, if COVID19 RNA changes from 5’ GGGUACAUGGUAGCCCCCGUCGAG …. 3’ to 5’ GGGUACAUGGUAGCCCCCGUCGCCCCGUAG …. 3’ Which of the following describes the above event? a) an insertion mutation occurred b) a duplication mutation occurred c) a multi-points mutation occurred d) a point-series mutation occurred e) an inversion mutation occurred
Please explain one type of “DNA repair” mechanism (what is it, when is it used, how does it work).
“Using this strand of DNA (TACAACTGA), show what a deletion and insertion would look like”
Topoisomerases (a) synthesize DNA (b) synthesize RNA primers(c) join Okazaki fragments (d) break and rejoin DNA to reduce torsional strain (e) prevent single DNA strands from joining to form a double helix
Explain how DNA polymerase and topoisomerase 2 contribute to replication in E.coli and what is the role of the role of the metal ions in the polymerase activity. B)How does the use of an RNA primer rather than a DNA primer affect the fidelity of DNA replication in E.coli?