In biotechnology, gene cloning is a crucial technique used in many genetic modification experiments. A vector is normally required to perform this process. The vector commonly used to transform a bacterial host cell is known as a plasmid. Below is the general plasmid map of pBR322. Elaborate the functions of ori, ApR and TeR present in pBR322. Bul 3759 Prul 3733 пы 3787 Pull 3607 Barbi 3002 Asel 3537 Bal 3433 Bad 3420 Floci 3905 Scal 3844 Ahdi 3361 Acul 3000" AlwNI 2884 Earl 4155, Acul 4048 Xest 3961 Bell 2777 Bef1 2682 Aatll-Zel 4284 BI 4209 B 4205 Sspl 4168 Dell 2575 Poil-Att 2473 BarB 2404 Troll 450 Earl 2351 BspQI-Sapl 2350 Ndel 2295 BAP 2291 171-A 2244 Cial-Ispt 23 Hindill 29 pBR322 4,361 bp Ball 2225 Th1111 - Part 2217 rop EcoRY 185 Bmtl-Nhel 229 Hamill 375 Xml 2029 Pull 2064 BamB 2122 Dell 2182 Sgr 400 Ball 471 Bani 485 Bigl 128 Sphl 562 EcoN1 822 Sall-Acol-Hinell 651 Pshu 712 Engl 939 BY1 949 Nrul 972 BAPT 1045 BspMi-fuAl 1063 PAMI 1315 Bami 1383 PM 1364 Styl 1309 Aval-Boll 1425 PMI 1438 Msel 1444 Bigl 1447 PMI 1480 Bgl 1650 Bap 1664 BsaBl 1668

Q: if telophase I of meiosis contains 2 chromatids or only one chromatid.

A: Meiosis is a cell division seen in sexually reproducing organisms. * Meiosis reduces the number of…

Q: Determine if the cells in prophase II of meiosis are haploid or diploid.

A: Mitosis and meiosis are two kinds of cell division that occur to form daughter cells. Mitosis occurs…

Q: -emes that Force static bodies? 7

A: Homeostasis is the tendency to resist change in order to maintain a stable, relatively constant…

Q: what is the reason for an individual to have fasting high HDL levels. list and explain reasons.…

A: Introduction:- HDL ( High Density Lipoproteins) is an essential and good form of the cholestrol…

Q: Dust explosions can be destructive and deadly, so how can this occur and would how you classify this…

A: The fast burning of minute particles floating in the air within a confined environment is known as a…

Q: Red hair is recessive to dark hair. If red-headed Jack fathers a child with red-headed Lisa, what…

A: Red hair is recessive, dark hair is dominant. Father and mother are red-haired. Let "D" be the…

Q: the term refers to (DNA, RNA, protein) and 2) what process it most directly functions in. NOTE: also…

A: The genes are present in DNA. These control the expression of phenotypes.

Q: GENETICALLY MODIFIED CROP: mRNA 5' tRNA nucleus O Į CAGTTAATGGAGCGATGCCTGGATGGAGAAATCAATTAG nucleus…

A: The genetic code is a set of instructions that enable live cells to produce proteins using genetic…

Q: Vitamin list: Vitamins may be used more than once  Thiamin Folate  Riboflavin Vitamin B12  Niacin…

A:

Q: arrived from the mainland 100 years (at least 50 generations) ago on been little or no gene flow…

A: Many of the hypothese regarding the genetics of adaptation require that one know specific details…

Q: Which of the following specifically explains why glucose uptake into intestinal cells happens in…

A: Absorption is the process by which the end products of digestion pass through the intestinal…

Q: Consider the image below. This image shows plasmid DNA isolated through exactly the same method that…

A: Plasmid DNA In contrast to a cell's chromosomal DNA, plasmidsare tiny, circular, double-stranded DNA…

Q: Pituitary secretion of adrenocorticotropic hormone (ACTH) is inhibited by elevated levels of: Group…

A: Adrenocorticotropic hormone  is also called as ACTH is the harmone released by the pituitary gland.…

Q: is the PCT because it has the "brush border" B is the glomerulus A is the Distal Convulated…

A: The parts mentioned in the micrograph are the parts of nephron. Each nephron is the smallest…

Q: Fatty acids activate Thermogenin, UCP-1 Channel H Hº H H H H' UCP-1 disturbs proton gradient H Hº H+…

A: Aerobic cellular respiration involves production of energy in the presence of oxygen from the…

Q: Determine if the cells in telophase I of meiosis are haploid or diploid.

A: Telophase I is a phase observed in the process called meiosis. Meiosis or reductional division is…

Q: SITUATION: A 70-year-old retired welder who is a heavy smoker arrives to the emergency room…

A: It is well known that smokers are more prone to a wide range of chronic illnesses and ailments than…

Q: explain and proivde anylyses what are the diagnoses and current and potential future treatments for…

A: adenocarcinoma tumors colorectal cancer  (colon)  can be diagnosed by following tests 1. Blood test-…

Q: XAMPLE 2: The parents in the family above produce another son, this time with two Y chromosomes and…

A: The nondisjunction occurs in the father in which during the second meiotic division nondisjunction…

Q: ing statements about promoters that are true. A promoter specifies where RNA polymerase initiates…

A: Promoter is a specific sequence of dna, where it's length can vary from organism to organism.…

Q: Choose all the answers that apply. Where are osteoprogenitor (osteogenic) cells found?…

A: Introduction: Osteoprogenitor cells, sometimes termed to as osteogenic cells, are stem cells that…

Q: Determine if anaphase of mitosis contains 2 chromatids or only one chromatid.

A: Mitosis It is a cell division in which the mother cell divides into two progeny with the exact same…

Q: Describe the importance of dietary sugars and lipids. In your answer, discuss in detail the impact…

A: Introduction  A macromolecule, such as a protein or nucleic acid, is a very big molecule crucial to…

Q: Neisseria lactamica Pseudomonas aeruginosa Pseudomonas fluorescens Pseudomonas putida Alcaligenes…

A: Bacteria are identified using various biochemical tests and staining techniques. The best example is…

Q: Fill in the blanks.  Blanks with the same letter are the same molecule.       Molecules to use:…

A: Water is necessary for transpiration, photosynthesis, and respiration in order for plants to grow…

Q: How does Frequent wakefulness during sleep limits the sleep status in older people?   Please…

A: introduction : Adults frequently experience sleep difficulties, which can be attributed to a variety…

Q: Photosynthetic rate of trees with less sunlight will be lower than areas with more sunlight?…

A: Photosynthesis is the process by which green plant prepared their food with the help of sunlight,…

Q: Imagine you are studying two eukaryotic species. The genome of Species A is 100 Mb in size. The…

A: Genome is defined as haploid set of chromosome of a cell or total genetic material of gamete cell in…

Q: Canthium wenzelii and Canthium sp. What will happen to the two Canthium species, which have their…

A: Canthium is a genus of flowering plants in the Rubiaceae family. They are small trees and shrubs.…

Q: A given substance would require active transport across a lipid bilayer into a cell if... (choose…

A: There are various means of transport that are used to carry out transportation in plant and animal…

Q: The graph shows the rate of transpiration (Est) for four plant species. Nothofagus dombeyi was the…

A: N.dombeyi at mid day in summer, suggesting reversible reduction in photochemical efficiency of…

Q: A) What module can we use to run BLAST over the internet in Biopython: Bio.Blast.NCBIWWW…

A: Biopython is a popular application programming interface (API) containing free tools, and are…

Q: During PCR, the reaction mixture cycles through three temperatures (for example 94, 60, and 72…

A: Introduction :  Using the thermo-resistant DNA polymerase, the polymerase chain reaction, also known…

Q: micronized R Progesterone, Glycerin Methylcellulose (1%) Solution 4 g 5 mL 50 mL 100 mL Cherry Syrup…

A: The amount of solute that has been dissolved in a specific volume of solvent or solution is measured…

Q: Below is the skeletal formula of a molecule typically found in cell membranes. What type of molecule…

A: The plasma membrane of the cell determine the movement of molecules in and out of the cells. The…

Q: A 'wild-type' allele is the allele that is ..(1)....  a population, and that encodes a  ..(2)......…

A: As per our guidelines we are supposed to answer only ? One question ( if there are multiple…

Q: Research suggests that newborns are able to discriminate their own language from a foreign language,…

A: Research shows that babies only hours old are able to differentiate between sounds from their native…

Q: 22. VIRAMUNE Oral Suspension contains 1% w/v of nevirapine. Calculate the milli- grams of nevirapine…

A: VIRAMUNE: Nevirapine (NVP), marketed among other names as Viramune, is a drug intended to treat and…

Q: 3d bioprinting systems, biomaterials, tissue engineering. Indicate 3 creative project topics on the…

A: 3d bioprinting :  The process that utilizes the living cells along with the biomaterial to produce…

Q: What significance does the relative size of exons and introns have for the evolution of genes and of…

A: Transcription is a process of synthesis of one stranded mRNA from two stranded DNA . This process…

Q: Search for genes involved in envelope components by searching the gene annotations and report how…

A: …

Q: Besides the pUC series, there are other plasmid vectors in the market such as pBR327 and pGEM-T.…

A: Cloning methods are used in biotechnology for various purposes. TA cloning is the technique that…

Q: Complete the table below by giving a complete description of the following common viral infections…

A: Viral infections are the infections caused by viruses which are made of genetic material inside of a…

Q: Perspective on any ethical considerations which engineers should consider when developing code to…

A: With the advancement of medical science, it is now possible to extend life as well as stop or…

Q: Someone who has been running a race is probably quite hungry at the end of it, while  someone who…

A: Introduction Digestion is the complex process in which complex substances are broken down into…

Q: How does a shunt benefit digestion in crocodiles?

A: Shunt It refers to the atypical blood flow through the heart. In spite of having an anatomically…

Q: Based on the information provided, you can infer that individual III-1 inherited both the      A.)…

A: A pedigree is a graph that shows how a characteristic or medical condition is passed down via family…

Q: 3 in 3' 5' 5' 3'

A: * DNA replication is a process in which, double stranded DNA will be copied to produce two identical…

Q: Describe the human condition that results from the abnormal development of the neural crest and…

A: Introduction :- The majority of the peripheral nervous system (PNS) and several non-neural cell…

Q: To investigate the properties of cell membranes, a scientist used the Fluorescence Recovery After…

A: Specific light wavelengths stimulate fluorescent markers, which then emit light with a different…

Bacterial Genomics

The study of the morphological, physiological, and evolutionary aspects of the bacterial genome is referred to as bacterial genomics. This subdisciplinary field aids in understanding how genes are assembled into genomes. Further, bacterial or microbial genomics has helped researchers in understanding the pathogenicity of bacteria and other microbes.

Transformation Experiment in Bacteria

In the discovery of genetic material, the experiment conducted by Frederick Griffith on Streptococcus pneumonia proved to be a stepping stone.

Plasmids and Vectors

The DNA molecule that exists in a circular shape and is smaller in size which is capable of its replication is called Plasmids. In other words, it is called extra-chromosomal plasmid DNA. Vectors are the molecule which is capable of carrying genetic material which can be transferred into another cell and further carry out replication and expression. Plasmids can act as vectors.