In Drosophila fruit flies, the gene controlling bristle length is X-linked. Wild type flies have long bristles; short bristles is a recessive trait. You cross a long-bristled female fly to a short-bristled male fly. All the F1 progeny have a wild type phenotype. Next, you cross the F1 flies to produce an F2 generation. If there are a total of 200 F2 flies, how many of the F2 females are expected to have short bristles?
Q: During an experiement, the value 0.0680 mg/ml was observed. The expected value is 0.75 mg in 90 mL.…
A: Answer : the value observed is = 0.0680 mg/ml the actual value is = 0.75 mg in 90 ml the actual…
Q: Describe what kind of pathological evalitations in short term in vivo test you would want to assess…
A: When performing brief in vivo safety assessments for a novel chemical designed for consumer…
Q: What is one anatomical trait that is present in both Adapoids and Omomyoids? A. A bony ear tube…
A: Adapoids are relatives of current day lemurs, lorises and bushbabies. They lived during the Eocene…
Q: external lactose 0000 cell membrane RNA polymerase promoter The role of lac permease is to: lactose…
A: In bacteria, the genes that encode the enzymes of a metabolic pathway are usually clustered together…
Q: Following is a list of constitutents found in eukaryotic cells. Rank each constituent in order, from…
A: Large and sophisticated creatures are made up of eukaryotic cells, which have a nucleus surrounded…
Q: bacterial replication fork
A: This is the site within a bacterial DNA molecule where the replication of DNA occurs actively.This…
Q: A simple diagram indicating the alterations in genetic content throughout mitosis could be prepared…
A: Mitosis is the cell division process that is responsible for the production of two diploid (2n)…
Q: -pecies 1 is described as 2n = 8 and has chromosome composition BBDDEEHH. pecies 2 is described as…
A: Trisomy is a condition where the organisms contain an extra copy of one of the chromosomes. In the…
Q: Suppose a mutant RNA polymerase Il is used that lacks one of the phosphorylation sites on the…
A: The production of RNA from the DNA template is known as transcription or gene expression. The main…
Q: A common soil fungal species is suddenly detected as an aggressive wheat pathogen, decimating crops…
A: Since you have posted multiple questions, we will provide the solution only for the first question…
Q: Identify the following: Description: Embryonic origin : Function : Location in the body: 1. Simple…
A: In the study of anatomy and biology, various types of epithelial tissues play critical roles in the…
Q: Describe the importance of the nitrogen and carbon cycles and the role of microbes in their…
A: Note:- Sorry, since you have posted multiple questions, as per the honor code, we will solve the…
Q: The most important reward circuit in the brain is the mesolimbic pathway. Dopaminergic neurons…
A: The mesolimbic pathway is a critical neural circuit in the brain associated with the experience of…
Q: Tackle the question of how we determine membership in a particular species?
A: Definition A species is a group of organisms having similar features. A particular species has…
Q: In the reaction below, the products have a higher free energy (G) than the reactants What can you…
A: The thermodynamic variable known as the Gibbs free energy change, abbreviated as G (delta G),…
Q: a B B A C B 7 B e y p The figure above shows images of five different cells. Each box contains an…
A: Mammals including humans show XY sex determination system in which the presence of Y-chromosome is…
Q: You are planning a trip to Kansas, in the United States this summer. Which of the following pictures…
A: Climate and precipitation patterns regulate biome distribution across the world. Different regions…
Q: Telomeres are at the end of linear chromosomes, and have a characteristic repeat sequence (5…
A: Telomeres are the repetitive nucleotide sequences present at the bottom of the chromosomes.These…
Q: Answer the following in terms of genetics: 1. Why is it expected for the larger popualtions to have…
A: Genetic variation refers to the diversity in genetic traits or characteristics within a population…
Q: two chromosomes with the same alleles in the same sequence two chromosomes with identical alleles…
A: According to the guidelines of Bartleby,“Since you have posted multiple questions, we will provide…
Q: is i 5' AACGATGCCATCAGAGCCCAGGACGTGATTTAA TTGCTACGGTAGTCTCGGGTCCTGCACTAAATT Ċ (c) wha 3' 5' se that…
A: Transcription is a process in which mRNA is synthesized with the help of DNA by the help of the…
Q: The diagram depicts the molecular structure of DNA. Label the diagram with the names of the…
A: Purines: adenine, guanine,Pyrimidines: cytosine, thymine, uracil.Nitrogenous base pairs with…
Q: Analyze the following pedigree and determine the mode of inheritance. Assume that the traits being…
A: The correct answer is option D. Sex-linked recessive.
Q: What codon results in a release factor entering the ribosome? 5' M GPPP-…
A: Translation is a process of formation of protein from mRNA. This process takes place in the…
Q: what would the Pharmacokinetics and Pharmacodynamics be of an hullicinate drug like LSD that acts as…
A: LSD (lysergic acid diethylamide) is a well-known psychedelic that acts as a partial agonist at the…
Q: Write down the energy content in kilo-calories (kcal) from one gram of fat, one gram of carbohydrate…
A: In the context of nutrition and dietary science, it is essential to understand the energy content of…
Q: Which of the following structures would never be found in a eukaryotic cell? Cell wall Cell…
A: A cell was discovered by Robert Hooke in 1665. The cell is the basic structural and functional unit…
Q: When stained with methylene blue (buccal cell) and haemalum acid (onion cell), the nuclei were the…
A: When stained with methylene blue (buccal cell) and haemalum acid (onion cell), the nuclei were the…
Q: Match each structure with the region of the blood vessel wall where it is found. Prompts Collagen…
A: These are the structures those carry blood through tissues and organs. They act as channels carrying…
Q: The role of allolactose in the lac operon
A: Lac Operon:This is a classic example of a gene regulation system found in E. coli.The key…
Q: TERMS BOX Endothermic Exothermic Catabolic Terms that describe this reaction Spontaneous Terms that…
A: Living organisms show metabolic activities in their cells that are responsible for maintaining the…
Q: 6 = W - 1 A 2 C ♦ ( ◆ ♦ N/A (> ◆ ◆
A: In a complementation chart a group will contain similar mutations that failed to compliment one…
Q: *Cystic fibrosis is a rare autosomal recessive condition. A phenotypically normal man whose father…
A: Mendel proposed three laws based on his research. His research provided a picture of the independent…
Q: 5. Refer to the text box about identifying the remains of the Russian royal family earlier in this…
A: When nuclear DNA is damaged or unavailable, mtDNA analysis is useful in forensic research, notably…
Q: Label each level of DNA packaging in the eukaryotic chromosome with the appropriate term. Supercoil…
A: Nucleic acids are biomolecules composed of repeating monomer units. There are two types of nucleic…
Q: The transportation of relatively small particles or liquids into the cell that are too big or unable…
A: Phagocytosis: When cells take in large particles, (cell eating).Pinocytosis: When cells take in…
Q: One example of non-Mendelian inheritance is uniparental inheritance. Choose the definition of…
A: Non-Mendelian genetics refers to inheritance patterns that do not follow the simple Mendelian…
Q: Observational studies conducted in the 1980s and 1990s indicated that women in therapy hormone…
A: The reason behind the contradiction between observational studies and more recent experimental…
Q: What is the size in µm of a cell that is 135mm wide in my photo? The scale bar in the photo is…
A: A microscope is a scientific instrument that allows us to see objects that are too small to be seen…
Q: Which of the following best describes a coenzyme? Small charged ions like Fe2+ that help an…
A: An enzyme is a biological catalyst that lowers the energy of activation for a given reaction that…
Q: Differentiate anaerobes from aerobes and describe how they are cultured. Explain how both aerobes…
A: Biofilms are structured communities of microorganisms that adhere to surfaces and are encased in a…
Q: In dosage compensation, do males sometimes overcompensate or is it always Barr body X-chromosome…
A: Dosage compensation is the process by which the organisms equalizes their genetic expression between…
Q: Molecules Toolbox: Glucose H₂O Outside of cell Na+ Inside of cell 0₂ NaCl 1) Passive diffusion Amino…
A: Active transport - Against the concentration gradient( low concentration→high concentration) and…
Q: What behaviors during the egg-laying season might lead to potential behavioral adaptations that…
A: characters During the breeding season,the following behaviors can lead to behavioral changes that…
Q: evolution genetic variation Hardy-Weinberg equilibrium genetic drift adaptations sexual reproduction…
A: Evolution is the gradual process through which living organisms change over time, typically due to…
Q: Discuss biofilms and their relevance to infectious diseases
A: According to the guidelines of Bartleby,Since you have posted multiple questions, the expert can…
Q: Question 32 The process resulting in an incorrect number of chromosomes is called ____. trisomy…
A: Questions to be answered in following steps:Question 32The process resulting in an incorrect number…
Q: A) carbon-hydrogen bonds B) NAD+ C) CO2 OD) NADH OE) ATP
A: According to the guidelines of Bartleby,Since multiple questions are posted, the expert can only…
Q: What letter in the diagram identifies the sporophyte? Which letter in the diagram indicates the…
A: The diagram illustrates the alternation of generations, a common life cycle observed in many plants…
Q: Damien and Jessica are friends that are interested in proteomics. One day Damien and Jessica go to a…
A: Hemoglobin is made up of heme as a prosthetic group and globin protein. There are two types of…
Trending now
This is a popular solution!
Step by step
Solved in 3 steps
- In Drosophila, two genes, one for body color and one for eye color, are carried on the same chromosome. The wild-type gray body color is dominant to black body color, and wild-type red eyes are dominant to purple eyes. You make a cross between a fly with gray body and red eyes and a fly with black body and purple eyes. Among the offspring, about half have gray bodies and red eyes and half have black bodies and purple eyes. A small percentage have: (a) black bodies and red eyes; or (b) gray bodies and purple eyes. What alleles are carried together on the chromosomes in each of the flies used in the cross? What alleles are carried together on the chromosomes of the F1 flies with black bodies and red eyes, and those with gray bodies and purple eyes?In Drosophila, the vermilion eye color is determined by a recessive allele, v, of an X-linked gene. The wildtype color is determined by the v+ allele and causes a brick red eye color. In a cross of a heterozygous female with a wild type male you observe 340 red eye females, 136 red eye males, and 90 vermillion males. Do these results follow your expectations?In Drosophila, vermilion eye color is due to a recessive allele (v) located on the X chromosome. Curved wings are due to a recessive allele (cu) located on one autosome, and ebony body is due to a recessive allele (e) located on another autosome. A vermilion male is mated to a curved, ebony female, and the F1 males are phenotypically wild-type. If these males were backcrossed to curved, ebony females, what proportion of the F2 offspring will be wild-type males?
- 2. a. A Drosophila male from a true-breeding stockwith scabrous eyes was mated with a female from atrue-breeding stock with javelin bristles. Both scabrous eyes and javelin bristles are autosomal recessive mutant traits. The F1 progeny all had normaleyes and bristles. F1 females from this cross weremated with males with both scabrous eyes andjavelin bristles. Write all the possible phenotypicclasses of the progeny that could be produced from the cross of the F1 females with the scabrous, javelin males, and indicate for each class whether it is arecombinant or parental type.b. The cross in part (a) yielded the following progeny:77 scabrous eyes and normal bristles; 76 wild type(normal eyes and bristles); 74 normal eyes andjavelin bristles; and 73 scabrous eyes and javelinbristles. Are the genes governing these traits likelyto be linked, or do they instead assort independently? Why?c. Suppose you mated the F1 females from the crossin part (a) to wild-type males. Why would thiscross fail…1. In Drosophila melanogaster (fruit fly) experiment, if we are going to cross male and female red-eyed fruit flies, we have the resulting offspring ratio of 50% red-eyed for female, 25 % for red-eyed male and 25% for white-eyed male. Females which are either homozygous or heterozygous for a trait still expressed eye redness whereas males can easily be affected. Why is this so? a. Females are the carriers of a gene for eye redness b. Y chromosome is responsible for red eyes in fruit flies, c. The gene for eye redness is an X-link dominant trait, d. Having a red-eyed trait is dominantly expressed by femalesIn Drosophila, a heterozygous female for the X-linkedrecessive traits a, b, and c was crossed to a male that phenotypically expressed a, b, and c. The offspring occurred inthe following phenotypic ratios.+ b c 460a + + 450a b c 32+ + + 38a + c 11+ b + 9 No other phenotypes were observed.(a) What progeny phenotypes are missing? Why?
- : In Drosophila, yellow body is due to an X-linked gene that is recessive to the gene forgray body.(a) A homozygous gray female is crossed with a yellow male. The F1 are intercrossed toproduce F2. Give the genotypes and phenotypes, along with the expected proportions, of theF1 and F2 progeny.(b) A yellow female is crossed with a gray male. The F1 are intercrossed to produce the F2.Give the genotypes and phenotypes, along with the expected proportions, of the F1 and F2progeny.(c) A yellow female is crossed with a gray male. The F1 females are backcrossed with graymales. Give the genotypes and phenotypes, along with the expected proportions, of the F2progeny.(d) If the F2 flies in part b mate randomly, what are the expected phenotypic proportions offlies in the F3??In Drosophila, a heterozygous female for the X-linkedrecessive traits a, b, and c was crossed to a male that phenotypically expressed a, b, and c. The offspring occurred inthe following phenotypic ratios.+ b c 460a + + 450a b c 32+ + + 38a + c 11+ b + 9 No other phenotypes were observed.(a) What is the genotypic arrangement of the alleles ofthese genes on the X chromosome of the female?In the fruit fly, dumpy wings (d) and purple eyes (p) are encoded by mutant alleles that are recessive to those that produce wild type traits; long wings (d+) and red eyes (p+). These two genes are on the same chromosome. In a particular lab, two researchers Walt and Jesse crossed a fly homozygous for dumpy wings and purple eyes with a fly homozygous for the wild type traits. The F1 progeny, which had long wings and red eyes, was then crossed with flies that had dumpy wings and purple eyes. Unfortunately, the progeny of this cross somehow escaped. To prevent their other projects from contamination, they decided to spend an exceptionally boring hour in the lab catching and counting the progeny and found the following: long wings, red eyes – 482 dumpy wings, purple eyes – 473 long wings, purple eyes – 23 dumpy wings, red eyes - 22 What is the genetic distance between these two loci? a. 4.5 cM b. 55 cM c. 45 cM d. 49.5 cM e. 4.7 cM
- In Drosophila, a heterozygous female for the X-linkedrecessive traits a, b, and c was crossed to a male that phenotypically expressed a, b, and c. The offspring occurred inthe following phenotypic ratios.+ b c 460a + + 450a b c 32+ + + 38a + c 11+ b + 9 No other phenotypes were observed.(a) Determine the correct sequence and construct amap of these genes on the X chromosome ?Vermilion eye color in Drosophila is sex-linked and recessive. What would be the phenotypes of maleand female progenies of a cross between a 6 vermilion female and 6 wild-type (red) male. what is the f1 and f2 generation. if a reciprocal cross is done containing 6 WT females with 6 mutant males what is the F1 and F2 generation. Do they contain the single gene or double gene?A recessive mutation pd causes purple eyes in Drosophila, in contrast to the wildtype red eyes. A dominant suppressor called Su can restore the color of pd/pd fly eyes to red. If you cross a pd/+ ; Su/+ fly to a pd/pd ; +/+ fly, what proportion of the offspring will have purple eyes?