In Ex 1.1 we used the Wizard DNA isolation kit to isolate the pCR2.1 vector and in Ex 1.11 we used the boiling miniprep isolation method to isolate the putative pCR2.1-NPR1 plasmids. Explain how the separation of the chromosomal DNA from the plasmid DNA is similar in the two methods and how it is different.

In Ex 1.1 we used the Wizard DNA isolation kit to isolate the pCR2.1 vector and in Ex 1.11 we used the boiling miniprep isolation method to isolate the putative pCR2.1-NPR1 plasmids. Explain how the separation of the chromosomal DNA from the plasmid DNA is similar in the two methods and how it is different.

Biology Today and Tomorrow without Physiology (MindTap Course List)

5th Edition

ISBN:9781305117396

Author:Cecie Starr, Christine Evers, Lisa Starr

Publisher:Cecie Starr, Christine Evers, Lisa Starr

Chapter10: Biotechnology

Section: Chapter Questions

Problem 8SQ

See similar textbooks

Similar questions

What is the formula used to calculate the number of DNA molecules which will be created for a given number of PCR cycles.
A PCR reaction was performed to amplify the CHE2 gene. The PCR primers used were designed to amplify bp 936-4,635 of a 10,908 bp plasmid. Calculate the expected PCR product size (in bp).
What size would the PCR product be for a different chromosome where there were nine tandem repeats.
Choose the correct gel electrophoretic pattern that would be seen in dideoxy sequence analysis of the DNADNA molecule shown below. pGGCGACCGATTAGTCCCATCGATGGG−OH
If insert DNA was obtained by PCR using Taq DNA polymerase, what shape does the end of this DNA fragment have?
Explain the importance of different temperatures in PCR.Tm of forward primer= 62 °CTm of reverse primer= 59 °CGene size= 3 Kb
Part A. If student counts 63 colonies on their 10^-6 dilution LB plate. What was the original concentration of their cells if they plated 100ul? Part B.If we used pGFPuv as the template for PCR positive control. This is because: a. it contains the GFP gene so it should show a product. b. It contains DNA fragments that were added to the ligation reaction. c. It is the desired plasmid we wanted to make. d. So we have a band to compare our unknown plasid to allowing us to check if the unknown is the right size.
In the second step of the PCR, the temperature is reduced to between 45-65 degrees C. What happens during this step?
In relation to the use of restriction enzymes in recombinant DNA technology, answer the following: You have accidentally torn the labels off two tubes (tube A and tube B), each containing a different plasmid, now you do not know which plasmid is in which tube. Fortunately, you have restriction maps for both plasmids, shown in Figure below. You have the opportunity to test just one sample from one of your tubes. By utilizing agarose gel electrophoresis technique, which restriction enzyme OR combination of restriction enzymes would you use in this experiment to determine which plasmid is found in which tube?. (Hint: if you use Hind III restriction enzyme you are going to get ONE single fragment with a molecular size of → 0.5+0.3+0.2+0.4+1+1 = 3.4 kb).
Match the PCR sample with the predicted result on the agarose gel. 1) Sample from individual homozygous for their PV92 locus with the Alu insert. Five bands of 100, 200 500, 700 and 1000bp Single band of 300 bp Two bands one of 300 bp and one of 641bp Tow bands one of 641 bp and one of 941 bp No Bends Single band of 941 bp Single band of 641bp 2) Sample from individual homozygous for their PV92 locus without the Alu insert. Five bands of 100, 200 500, 700 and 1000bp Single band of 300 bp Two bands one of 300 bp and one of 641bp Tow bands one of 641 bp and one of 941 bp No Bends Single band of 941 bp Single band of 641bp 3) Sample from individual heterozygous for their PV92 locus having the Alu insert. Five bands of 100, 200 500, 700 and 1000bp Single band of 300 bp Two bands one of 300 bp and one of 641bp Tow bands one of 641 bp and one of 941 bp No Bends Single band of 941 bp Single band of 641bp 4) Negative control sample. Five bands of 100, 200 500, 700 and 1000bp…
Ben used the following primer pairs to amplify the COI region of his DNA template: Afterwards, he used Agarose Gel Electrophoresis to visualize the PCR products. Based on the gel: a) Was he able to successfully amplify the desired region in all replicates? b) Are there errors in Ben's gel? Does he need to repeat his PCR?
Match the following terms with their definitions and label each component of the PCR mixture in the diagram (use the letters A-D):I. DNA polymeraseII. PrimersIII. NucleotidesIV. Genomic DNA template A. DNA that contains the target sequence that will be replicated using PCR.B. An enzyme that copies the DNA sequence.C. A mixture of 4 nucleotides (A,G,C, and T) that will be polymerized into the replicated DNA sequence.D. A short DNA sequence that allows the enzyme to bind and initiate polymerization.