In the three dimensional structures obtained of RNA polymerase lI bound to template DNA. RNA and incoming substrate NTPS Komberg and colleagurs concluded that there are two nucleotide binding sites, called the entry (E) site and acceptor (A) site. Which of the tollowing statements correctly cescribes features of the E or A site? Select one: O a. A nucleotide bound to the A site is not correctly positioned for pticsphodiester bond formation. O b. None of these correctly describes featurcs of these sites O C. The correct nucleotide tu be next added to the growing RNA trascript would first bind to the Asite and then later bindd to the E site O d. The A site will birid all nuclcotides regardless of whether or not they can correctly bae-pair to the template DNA, O e. Anucleotide bound tu the E site is not correctly positioned for phosphordiester bord formation

In the three dimensional structures obtained of RNA polymerase lI bound to template DNA. RNA and incoming substrate NTPS Komberg and colleagurs concluded that there are two nucleotide binding sites, called the entry (E) site and acceptor (A) site. Which of the tollowing statements correctly cescribes features of the E or A site? Select one: O a. A nucleotide bound to the A site is not correctly positioned for pticsphodiester bond formation. O b. None of these correctly describes featurcs of these sites O C. The correct nucleotide tu be next added to the growing RNA trascript would first bind to the Asite and then later bindd to the E site O d. The A site will birid all nuclcotides regardless of whether or not they can correctly bae-pair to the template DNA, O e. Anucleotide bound tu the E site is not correctly positioned for phosphordiester bord formation

Biochemistry

6th Edition

ISBN:9781305577206

Author:Reginald H. Garrett, Charles M. Grisham

Publisher:Reginald H. Garrett, Charles M. Grisham

Chapter29: Transcription And The Regulation Of Gene Expression

Section: Chapter Questions

Problem 16P

See similar textbooks

Similar questions

The following sequence of nucleotides is found in a single-stranded DNA template: ATTGCCAGATCATCCCAATAGAT Assume that RNA polymerase proceeds along this template from left to right. Q.Which end of the DNA template is 5′ and which end is 3′?
The RNA polymerase from bacteriophage T7 diff ers structurally from prokaryotic and eukaryotic RNAPs and is extremely specifi c for its own promoter. Why do these properties make T7 RNAP useful in experiments with recombinant DNA?
Assume the following DNA template strand: 3'-ATA GCG AGG AGT ATC-5' A) What would be the protein associated with this DNA template strand? Give the sequence of amino acids encoded by this fragment. Leave traces of your steps. B) In the synthesis of this protein, what are the codon and the anticodon for? Explain in one sentence for each. C) We find, in another cell, a mutation of this DNA template strand: 3' ATA GCG TGG AGT ATC-5’ 1. What type of point mutation is it? 2. Did this mutation arise during transcription, translation or DNA replication? D) If this mutation is found in a spermatozoon, will it have an effect on the individual, its offspring or both? Briefly explain
Assume that the sequence of bases shown below is presenton onenucleotide chain of a DNA duplex and that the chain has openedup at a replication fork. Synthesis of an RNA primer occurs on thistemplate starting at the base that is underlined.(a) If the RNA primer consists of eight nucleotides, what is itsbase sequence?(b) In the intact RNA primer, which nucleotide has a free 3'-OHterminus?3'.......GGCTACCTGGATTCA....5'
a) Replicate this sense strand to create a double-stranded DNA helix TGAGGATGAAACTCACACCGGGGCGCAGTTTGGCACTTAGATTCTTGTACACGACCTAGTATAACACAGTT b) Using this DNA double helix, express the gene – i.e. determine the resulting polypeptide sequence by using the correct reading frame. When you get to the stop codon – you may write an asterisk (i.e. a “*”) to denote the stop codon. c) Does the sense strand DNA sequence have 5’ and 3’ UTR sequences? If so – write them in the space below 5’ UTR: 3’ UTR:
The modular nature of eukaryotic activator proteinsgave scientists an idea for a way to find proteins thatinteract with any particular protein of interest. Theidea is to use the protein–protein interaction to bringtogether a DNA-binding region with an activation region, creating an artificial activator that consists oftwo polypeptides held together noncovalently by theinteraction.The method is called the yeast two-hybrid system,and it has three components. First, the yeast contains areporter gene construct in which UASG (an enhancerlike sequence that binds the activator Gal4 as describedin Problem 8) drives the expression of an E. coli lacZreporter (encoding the enzyme ß-galactosidase) from ayeast promoter. Second, the yeast also expresses a fusion protein in which the DNA-binding domain of Gal4is fused to the protein of interest; this fusion protein iscalled the bait. The third component is a cDNA librarymade in plasmids, where each cDNA is fused in frameto the activation domain of…
Strand directed mismatch repair corrects copying erros based on Which of the following apply to the statement above, there maybe more than one. a. the strand containg breaks in the sugar backbone of the replicated DNA b. structurral instabilities created between oncorrect base pairing and associated histone proteins c. mutations that are evolutionary beneficial to an organims and recults in these areas of the genetic code to be turned off d. methylation of adenosine in GATC sequences during bacterial DNA replication e. repair sequence motifs that attract DNA polymerase gamma
An experiment is performed with Primase, using a specific DNA template. In this experiment, you provide NTPs (ATP, UTP, CTP, GTP) which contained only one radioactive phosphate group, in the alpha-phosphate position (the alpha-phosphate is the one attached to the sugar. the other phosphates are beta and gamma). After RNA synthesis occurs, you separate the resultant RNA strand and any of the NTPs that have not been incorporated into the RNA, and measure the radioactivity of the newly synthesized RNA. 1. If you did the experiment, with all the NTPs provided, but only the beta phosphate was radioactive for each of the NTPs, would radioactivity be found in the RNA?
Imagine a warm pond on the primordial Earth.Chance processes have just assembled a single copy of anRNA molecule with a catalytic site that can carry out RNAreplication. This RNA molecule folds into a structure thatis capable of linking nucleotides according to instructionsin an RNA template. Given an adequate supply of nucleo-tides, will this single RNA molecule be able to use itself as atemplate to catalyze its own replication? Why or why not?
The following sequence of nucleotides is found in a single-stranded DNA template: ATTGCCAGATCATCCCAATAGAT Assume that RNA polymerase proceeds along this template from left to right. Q.Give the sequence and identify the 5′ and 3′ ends of the RNA transcribed from this template.
The following sequence of nucleotides is found in a single-stranded DNA template: ATTGCCAGATCATCCCAATAGAT Assume that RNA polymerase proceeds along this template from left to right.
The restriction endonuclease PstI cuts DNA symmetrically on both strands at the sequence: CTGCAG GACGTC On the resulting DNA fragments are left 3’ overhanging ends of 4 nucleotides. PstI cleavesthe phosphodiester backbone with a-type specificity. In short-hand notation, showing theidentity of phosphates on the ends, draw the two fragments that result from PstI digestion ofthe following double-strand ed oligonucleotide: 5’-pAATTGCTACTGCAGAACCGG-3’ 3’-TTAACGATGACGTCTTGGCCp-5’