The restriction endonuclease PstI cuts DNA symmetrically on both strands at the sequence: CTGCAG GACGTC On the resulting DNA fragments are left 3’ overhanging ends of 4 nucleotides. PstI cleavesthe phosphodiester backbone with a-type specificity. In short-hand notation, showing theidentity of phosphates on the ends, draw the two fragments that result from PstI digestion ofthe following double-strand ed oligonucleotide: 5’-pAATTGCTACTGCAGAACCGG-3’ 3’-TTAACGATGACGTCTTGGCCp-5’

The restriction endonuclease PstI cuts DNA symmetrically on both strands at the sequence: CTGCAG GACGTC On the resulting DNA fragments are left 3’ overhanging ends of 4 nucleotides. PstI cleavesthe phosphodiester backbone with a-type specificity. In short-hand notation, showing theidentity of phosphates on the ends, draw the two fragments that result from PstI digestion ofthe following double-strand ed oligonucleotide: 5’-pAATTGCTACTGCAGAACCGG-3’ 3’-TTAACGATGACGTCTTGGCCp-5’

Biochemistry

6th Edition

ISBN:9781305577206

Author:Reginald H. Garrett, Charles M. Grisham

Publisher:Reginald H. Garrett, Charles M. Grisham

Chapter28: Dna Metabolism: Replication, Recombination, And Repair

Section: Chapter Questions

Problem 13P: Chemical Mutagenesis of DNA Bases Show the nucleotide sequence changes that might arise in a dsDNA...

See similar textbooks

Similar questions

The restriction endonuclease NciI recognizes and cuts the five-base-pair sequence 5’- CC(G/C)GG-3’ [where (G/C) means either G or C will work at that position]. (1) How often, on average, would this sequence occur in random DNA? Assume the DNA contains 25% each of A, G, T & C. (2) After digestion, Nci1 leaves a one-base 5’ overhang. Write/draw the cut site/digested products.
When circular DNA is sequenced, the nucleotide base pairs are numbered starting from a fixed position on the DNA, all the way around, usually in a clockwise manner. a DNA molecule that is 3133 base pairs long is digested with RsaI restriction enzyme recognition sites at base numbers 366, 1534, and 2207. What are the sizes of the DNA fragments that will be produced after the DNA is digested with RsaI?
After restriction enzymes cut, they contain unpaired bases. Type II restriction enzymes leave ends that may be 5' overhanging, 3' overhanging, or blunt. In all cases each end is left with a 3' OH and a 5' phosphate. All blunt ends, and any complementary overhanging ends may be re-ligated with T4 DNA ligase, as long as at least one 5'- phosphate is present. In the tables below G^AATTC means that the end after cutting with enzyme will be: -----G 3' -----CTTAA 5' GTGCA^C means that the end will be: -----GTGCA 3' -----C 5' Which RE’s from table below have a 5’ overhang? Which ones have a 3’ Overhang? AccI GT^CGAC BamHI G^GATCC ClaI AT^CGAT NsiI ATGCA^T PstI CTGCA^G BglII A^GATCT TaqI T^CGA
Given the following coding sequence for DNA, provide the sequence of the complementary(template) sequence. 5’ ATGCATAGATTAGGATATCCCAGATAG 3’
the restriction enzyme NotI recognizes the following sequence : 5'-GCGGCCGC-3' . On average, how oftern should this enzyme cleave DNA?
The restriction enzyme Alu I cleaves at the sequence 5’-AGCT- 3' , and Not I cleaves at 5' -GCGGCCGC-3'. What would be the average distance between cleavage sites for each enzyme on digestion of double-stranded DNA? Assume that the DNA contains equal proportions of A, G, C, and T.
The restriction endonuclease NotI recognizes the octanucleotide sequence GCGGCCGC. Calculate the expected number of NotI cleavage sites in the bacteriophage λgenome, a linear DNA duplex 48.5 kbp in length with a (G + C) content of 50%.
A lagging strand is sketched below. The Okazaki fragment DNA is red, and the RNA primers aredashed orange lines. Which Okazaki fragment was made first? When ligase joins fragments Aand B, will it act at arrow 1, arrow 2, or both?
The restriction enzyme BamHI recognizes the sequence GGATCC and cuts the DNA between the two G’s. Given the following segment of double-stranded DNA, draw the sticky ends that result from cleavage with this enzyme
The partial sequence of one strand of a double-stranded DNA molecule is5′ – – – GACGAAGTGCTGCAGAAAGTCCGCGTTATAGGCATGAATTCCTGAGG – – – 3′The cleavage sites for the restriction enzymes EcoRI and PstI are shown below.Write the sequence of both strands of the DNA fragment created when this DNA is cleaved with both EcoRI and PstI. The top strand of your duplex DNA fragment should be derived from the strand sequence given above
A molecule of double-stranded DNA that is 5 million base pairs long has a base composition that is 62% G + C. How many times, on average, are restriction sites for the following restriction enzymes likely to be present in this DNA molecule? a. HindIII (recognition sequence is AAGCTT)
A lagging strand is sketched below. The Okazaki fragment DNA is red, and the RNA primers are dashed orange lines. a) Which Okazaki fragment was made first, A, B, or C? b) When ligase joins fragments A and B, will it act at arrow 1, 2, or both?