1) You would like to clone a gene by PCR. The sequence of the two ends of the coding strand for the gene is provided below. АTGAAATCTАCGTTTCAC .. СССССAGTACCCCССТТА ................ Which following pair of primers would direct the amplification of this gene? All sequences are written from 5' to 3'. а. АTGAAATCТАCGTTTCAС; ССССАGTCСССССТТА b. ATGAAATCTACGTTTCAC; TAAGGGGGGTACTGGGGG c. TACTTTAGATGCAAAGTG; ATTCCCCCCATGACCCCC d. GTGAAACGTAGATTTCAT; ATTCCCCCCATGACCCCC

1) You would like to clone a gene by PCR. The sequence of the two ends of the coding strand for the gene is provided below. АTGAAATCTАCGTTTCAC .. СССССAGTACCCCССТТА ................ Which following pair of primers would direct the amplification of this gene? All sequences are written from 5' to 3'. а. АTGAAATCТАCGTTTCAС; ССССАGTCСССССТТА b. ATGAAATCTACGTTTCAC; TAAGGGGGGTACTGGGGG c. TACTTTAGATGCAAAGTG; ATTCCCCCCATGACCCCC d. GTGAAACGTAGATTTCAT; ATTCCCCCCATGACCCCC

Name: 1) You would like to clone a gene by PCR. The sequence ofthe two ends
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: 1) You would like to clone a gene by PCR. The sequence ofthe two ends of the coding strand for the gene is providedbelow.АTGAAATCTАCGTTTCAC.... ССССAGTACCCСССТТАWhich following pair of primers would direct the amplificationof this gene? All sequence

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter19: Genomes And Proteomes

Section: Chapter Questions

Problem 1TYK

See similar textbooks

Similar questions

Here another DNA sequence that will amplify another gene known to confer the ability to taste additional bitter compound. You would like to perform a PCR to amplify this sequence. Which pair of primers was used to amplify this sequence? 5' TAGAAAAGGAAGGTGGCTCCTACAAATGCCATCATTCTCTGCCGAATCAGTGGTCCCAAAGATGGA GTGGTCCCAAAGATGGACCCCCACCCACGAGGAGCATCGTGGAAAAAGAAGACGTTCCAACCACC 3' 5'-TAGAAAAGGAAGGTGGCT-3' and 5'-TTGAAGACGTGGTTGGAA-3' O 5'-AGCCACCTTCCTTTTCTA-3' and 5'-AACTTCTGCACCAACCTT-3' O 5'-TTGAAGACGTGGTTGGAA-3' and 5'-AGCCACCTTCCTTTTCTA-3' O 5'-TAGAAAAGGAAGGTGGCT-3' and 5'-AACTTCTGCACCAACCTT-3'
Consider a partial restriction digestion, in which genomic DNA is exposed to a small, limiting amount ofa restriction enzyme for a very short period of time.a. Would the resultant fragments be longer or shorteror the same size as those produced by a completedigestion?b. If you prepared genomic DNA from a tissue sample containing millions of cells, would the fragments produced by partial digestion of DNA fromall of these cells be the same or different?
You want to identify and compare the gene expression profile of several genes in a disease. Will you be able achieve this using Q-PCR technique? Can you identify a potential mutation (the nucleotide change) within a gene sequence using conventional PCR? If not, then what approach you should take?
the one above: Replicate this sense strand to create a double-stranded DNA helix TGAGGATGAAACTCACACCGGGGCGCAGTTTGGCACTTAGATTCTTGTACACGACCTAGTATAACACAGTT Compare this mutated sense sequence given below to the original one given above and identify and classify all mutations that can be found in this new DNA sequence? TGAGCATGAAACTCACACCGGGGGCAGTTTCGCACTTAGGATTCTTGTACAGGACCTAGTATAACAAGTT 2. Using this mutated DNA strand, express it as a polypeptide by using the correct reading frame. When you get to the stop codon – you may write an “*” to denote the stop codon. 3. How many amino acids were changed in the mutated polypeptide?
In a transformation experiment, donor DNA was obtained from aprototroph bacterial strain (a+b+c+), and the recipient was a tripleauxotroph (a-b-c-). What general conclusions can you draw aboutthe linkage relationships among the three genes from the followingtransformant classes that were recovered? a+ b- c- 180 a- b+ c- 150 a+ b+ c- 210 a- b- c+ 179 a+ b- c+ 2 a- b+ c+ 1 a+ b+ c+ 3
You would like to amplify the gene shown here using PCR. Assume the primer to the 5' end of the gene sequence shown has already been designed. You need to design a primer to hybridize with the sequence on the right side of the diagram. What will be the sequence of the primer? 5’ —GENE——AATTGGCG 3’ a) 3’ CGCCAATT 5’ b) 5’ GCGGTTAA 3’ c) 5’ CGCCAATT 3’ d) 5’ TTAACCGC 3’ e) 5’ AATTGGCG 3’
Ehat primer sets could be amplify the following DNA sequence? AATACGTCGCATGGggatccttttttatgcatg
You would like to amplify the gene shown below using PCR. What is the sequence of the primer you would generate for the left side of the sequence? a) 5’ GCGGTTAA 3’ b) 5’ CGCCAATT 3’ c) 5’ TTAACCGC 3’ d) 5’ AATTGGCG 3’
Researchers are manipulating the gene cxx2 for their experiments, and they have inserted a smallnumber of base pairs randomly somewhere into the gene. They isolate several versions (with differentinsertions) of this modified gene and carry out an RT-PCR using a primer that recognizes thetranscriptional start site area (eg. from +1 to +20), and a primer that binds to the polyA tail.For the first modified gene sample, they observe that the intron is no longer being spliced out.Which of the lettered arrowheads indicates a location where this insertion could be? (Therecould be one answer or several. Give all answers that apply)
Assume the sequence below is one half of a double stranded DNA template used in a PCR reaction. The highlighted sequences indicate the region bound by primers, either on this strand or on the other complementary strand. 5' ACGTGCGACACGTATATATGTCGCGTGAGTGTAGCGTATCGCTAGAGACGCATACCTATG 3' If the sequence of the forward primer is 5' GCGACACG 3', which of the following sequences would represent the reverse primer? a. 5’ – CAGAGATCGC – 3’ b. None of these sequences would represent the reverse primer c. 5’ – GTCTCTAGCG – 3’ d. 5’ – GCGATCTCTG – 3’ e. 5’ – CGCTAGAGAC – 3’
During PCR amplification in preparation for DNA sequencing, why were there different colors at the 3’ ends of the fragments produced? (What did these four colors represent?)
The target sequence for a PCR amplification is shown below. When the final cycle of PCR has ended, the resulting amplicon will be how many base pair (bp) long? 5' ACGTGCGAGCACGTATATATGTCGCGTGCTGAGTGTAGCGTATGCGAATCACCGC 3' 3' TGCACGCTCGTGCATATATACAGCGCACGACTCACATCGCATACGCTTAGTGGCG 5' 31bp 39bp 42bp 47bp None of the above