Q: What is the advantages if using Kato-Katz method?
A: Kato-Katz method is a widely adopted method to prepare human stools for examination of the presence ...
Q: Give a biologic example of the negative feedback loop?
A: Introduction :- A self-regulating system is a negative feedback loop, also known as an inhibitory lo...
Q: How might culture age affect the results of a spore stain? O If the bacterial culture is too young, ...
A: Bacteria are single-celled, tiny creatures that may enter healthy tissues and grow rapidly. The bact...
Q: Translate this RNA transcript: 5' - UUUCUUAUGUGUCGCCGUAAUUGAUAUUAC - 3'. O Phe-Leu-Met-Cys-Arg-Arg-I...
A: Note: As per Bartleby Guidelines For Remaining Answers Please Repost The Question. Introduction: Tra...
Q: corresponding
A: Vaccine effectiveness studies have conclusively demonstrated the benefit of covid 19vaccines in redu...
Q: A mass in the adrenal gland was found incidentally on a CT scan in a 40-year-old male patient. True ...
A: Adrenal glands are situated above the renal gland and so the name. It is a small gland which makes s...
Q: What the grandparents' genotypes are? Why doesn’t the father (II-1) have the disease breast cancer?...
A: Genetic inheritance is the process by which genetic information is passed from the parents to the pr...
Q: They have purified a 1100 bp HindIII restriction fragment that they plan to sequence. As a first ste...
A: EcoR1: EcoR1 is a restriction endonuclease enzyme found in the E. coli bacteria. It's a restriction...
Q: How are these examples of phenotypic plasticity? 1. Haman weight 2. UV exposure 3. Flower color/pH
A: Answer :- 1. Human weight :- Phenotype is the noticeable physical or biochemical qualities of a in...
Q: Which of the following season you would observe algal bloom (increased productivities) due to re-cir...
A: Algal bloom : It is an accumulation of algae in freshwater or marine water systems. During algal blo...
Q: 2. Indicate possible patterns of inheritance for the RARE traits shown in each of the pedigrees belo...
A: This particular pedigree shows following traits: 1. The affected trait appeared in generations in wh...
Q: Construct pedigree charts using the inheritance of hemophilia in figure 92 (page 113). This is X-lin...
A: Pedigree chart is a family tree helps to understand the inheritance of a particular trait or disease...
Q: 3. The free energy associated with the proton gradient that develops across the inner mitochondrial ...
A:
Q: Please choose all that apply for Phylum Arthropoda. segmentation coelom hemocoel O endoskeleton O op...
A: Introduction:- Animals without a notochord – the rod-like elastic structure that supports the body –...
Q: Connie accidentally touched the hot kettle. Explain what happens using your knowledge of withdrawal ...
A: Withdrawal reflex is automatic withdrawal from painful stimulus..
Q: Determine what the statement is describing. Fill in the blanks with the correct/best answer. 1. Est...
A: 1. The Nagoya Protocol establishes a framework that can help researchers to access genetic resources...
Q: The cornsnake (Pantherophis guttatus) has a recessive allele for pigmentation that causes albinism (...
A: Reptiles are the class of Animals that are cold blooded. They inhabit both, the land and the waters....
Q: Describe a nucleic acid.
A: Nucleic acids carry and store information and pass this information from parent cells to daughter ce...
Q: There are _ times less _ ions in solution with a pH 3 than in a solution with a pH6.
A: Introduction In a chemical reaction, a solution can be acidic or basic which depends on the concentr...
Q: autoimmune diseases?
A: Autoimmune disease : A disease in which the body's immune system attacks healthy cells.
Q: How is flower color/pH an example of phenotypic palicity
A: Introduction Plant is a multicellular eukaryotic life form that is characterized by process of photo...
Q: The den network of fibers that connect the two hemispheres is called the corpus Callosum. Much of wh...
A: The left and right hemispheres of the brain are symmetrical. The opposing side of the body is contro...
Q: What difference between RNA and DNA helps to explain the greater stability of DNA? What implications...
A: Deoxyribonucleic acid (DNA) is a molecule composed of two polynucleotide chains that twin around eac...
Q: distinguish between bacterial cells that obtained the plasmid and those that did not
A: Bacteria are single celled organisms with a unique internal structure.
Q: The Environment Act 2008 was repealed by the Environment Act 2002 True False
A: The Wild Life (Protection) Amendment Act, 2002 is an Act to provide for the protection of wild anima...
Q: What is the purpose of examining a specimen slide containing a stool sample in a clinical parasitolo...
A: Stool is more than just a waste product. In primary care, some stool tests can be used to differenti...
Q: What is the virulence factor of Mycobacterium tuberculosis
A: Virulence factors are specific molecules of pathogenic organisms that cause the invasion against the...
Q: What is the purpose of an autoclave and what is its mechanism?
A: Answer :- An autoclave is utilized in clinical and research facility settings to disinfect lab hardw...
Q: DNA polymerase III adds nucleotides to both ends of the RNA primer to the 5' end of the RNA primer
A: DNA is the genetic element found in all prokaryotic and eukaryotic cell types. DNA is a double-stran...
Q: 3. Describe three systems that are negatively influenced by chronic stress and the mechanisms and th...
A: Introduction: Stress:•A long-term feeling of being pressurised and overloaded, with symptoms such as...
Q: One of the frist steps in isolating plasmid DNA via mini-prep is to pellet the cells after O/N cultu...
A: 1) The use of Resuspension buffer in the extraction or the isolation of the plasmid from the DNA is ...
Q: Explain about the mechanism of genotoxic agent in validating the regulator histone h4 dosage modulat...
A: Introduction: Candida glabrata is a yeast that is haploid. C. glabrata is a common bacterium found i...
Q: 1) What piece of evidence initially convinced Dr. Alvarez that a mass extinction had occurred at the...
A: Fossils are the geologically preserved remains of previously lived animals, plants, or other living ...
Q: D) The root of a binary tree has i) 0 ii) 1 iii) 2 iv) 4 parent(s).
A: We’ll answer the first question since the exact one wasn’t specified. Please submit a new question ...
Q: 2 6 5 MAGIC CUP 3.
A: The above image shows different types of sharks, the identification of these are: 1) Rhincodon typu...
Q: Which of the following structures is a vesicle? Question 2 options: lysosome ribosome mi...
A: The cell is the smallest structural and functional unit of the living organism. Eukaryotic cells con...
Q: How might the Hardy Weinberg relationship be used to evaluate a new SNP genotyping technology using ...
A: Hardy Weinberg equilibrium states that the allele and genotype frequencies of the population will re...
Q: 8. In which of these clades (Deuterostomia, Lophotrochozoa, Ecdysozoa, Porifera, and Cnidaria) would...
A: Your answer has strating in step 2. Step 2 image is made by me, in MS word. This image not copied fr...
Q: At the hydrothermal vent in the deep sea, the specific symbiotic relationship between the bacteria t...
A: A close ecological link between organisms of two or more species is known as symbiosis. Sometimes bo...
Q: OBasophils O Macrophages
A: Phagocytic name is come from the greek work phagein that means to eat and 2nd word is cyte . phagoc...
Q: What is the importance of a reflex and why is it important in clinical examination?
A: Reflex: A reflex, also known as a reflex action, is an unintentional, unplanned sequence of action ...
Q: How does the insect circulatory system carry out physiological insect defence mechanisms? Is there a...
A: The circulatory system present in insects differ from the circulatory system found in human body. An...
Q: Sensate focus is the most common treatment for premature ejaculation. T or F?
A: Ejaculation can be defined as the process of releasing a sexual gamete that is sperm cells male repr...
Q: Elaborate on how the modification of the insect legs/limbs better equip the insect to survive in a g...
A: Insects have legs that are adapted as per their requirement for survival in their respective habitat...
Q: Aquaporins are proteins that control the passage of water molecules across a cell membrane. The prot...
A: Answer :- Option (C) is correct. - You will have to sequence the proteins to compare their primary s...
Q: Consider two genes that are next to each other on a chromosome, as arranged in the figure P0509 jpg ...
A: The production of RNA from the DNA is known as transcription or gene expression that occurs within t...
Q: Cells are? A. None of the above B. Atoms that are bound together C. Tiny units of matter that form m...
A: Answer: Cells are:- D) The smallest units of life. Cell is the fundamental unit of structure and fun...
Q: Round seed is dominant over wrinkled. Yellow cotyledon is dominant over green. Full pod is dominant ...
A: In this question, it is not mentioned whether it is dominant homozygous or dominant heterozygous. To...
Q: Draw a phylogenetic tree depicting our current understanding of the animal phylogeny. Include the ma...
A: Phylogenetic tree of animal is based on morphological, genetic and fossil evidence that helps us to ...
Q: Consider that leaves are added to a soil. The compound in the leaves that is most resistant to bacte...
A: Decomposition is process of decaying of materials.
Step by step
Solved in 3 steps
