Is there a connection between the regeneration of fish scales to its survival? If there is, then what are the factors?

Q: Insects are attracted to the flower of plants. When they rub against parts of the plant, they carry ...

A: The transfer of pollen grains(carrier of male gamete) from anther to stigma is known as pollination....

Q: Jane consumed a breakfast that contained 85 grams of carbohydrates, 20 grams of protein, and 18 gram...

A:  Energy(in kcal) = 4x ( protein and carbohydrate mass in gram ) + 9 x mass of fat in gram  Here ,  C...

Q: the Chronic Myelogenous Leukemia (CML)

A: A disease in which the bone marrow makes too many white blood cells is known as the chronic myelogen...

Q: 5'.GTCTCTTGACATTG... 3' What is the MRNA sequence transcribed from this sequence (assume the transcr...

A: Ans ) Always Guanine codes for cysteine only .. That is G-C Given.                   5'...GTCTCTTGAC...

Q: Spin 1.5 ml of cells in a microcentrifuge at maximum speed (12,000 rpm) for pellet. Remove the super...

A: To isolate plasmid DNA,  cells are cracked open and a mini preparation should be performed, trying h...

Q: Describe active transport across the plasma membrane marking note of concentration gradient Nd energ...

A: Cellular transport is a very important phenomena that occurs inside the cell because there are a lot...

Q: What is the function of DnaB, one of the three special proteins needed to form the initial replicati...

A: The replication process begins with the unwinding of the polynucleotide strand, which forms a replic...

Q: What is the myogenic response?

A: Myocytes, often known as muscle cells, are cells found in certain types of muscle tissues. They deve...

Q: Lipid-soluble molecules: O are considered polar molecules. O generally diffuse freely through the ce...

A: The correct answer is-  generally diffuse freely through the cell membrane.

Q: What is the consensus sequence of the bacterial promoter? (ΤΑΤΑAΤ 17±1 -- TTGACA O TTGACA 17±1 TATAA...

A: The promoter region of the organisms can be the Proximal promoter, core promoter, and distal promote...

Q: Required information 1Ab:1a B More A b and a B; and fewer A B and a b 1AB:1ab 1AB:1Ab:1 a B:1 ab Mor...

A:

Q: Which of the following statements about cholesterol is TRUE? A. Cholesterol has a multiple carbon-ri...

A: Because the majority of the cholesterol molecule is non-polar, it forms connections with the phospho...

Q: Use the picture below to answer the question. Coastal Bay Food Chain Algae Barracuda Damselfish Zoop...

A: The provided diagram describes the food chain of the coastal waters of Virginia. The food chain cons...

Q: Low-resolution X-ray diffraction analysis of a protein composed of long stretches of the sequence (-...

A: The X-ray diffraction is one of the analytical techniques in which the X-rays are used for analysis ...

Q: Which of the following statements about CRISPR are accurate? Select all that apply. O CRISPR require...

A: The most accurate statements regarding CRISPR are - a, c and e.

Q: QUESTION 1 Atherosclerosis is caused by: O Lipids being transported in the blood Hypertension leadin...

A: High blood pressure or hypertension is a condition where pressure exerted b blood against the wall o...

Q: • 1. Identify the tissue. • 2. Identify the structures pointed by letter "A." • 3. Identify the stru...

A: The group of cells which function together and have same structure are called as tissues.

Q: Explain how viruses and prions are both similar and different.

A: ANSWER;- 1)  Prions are smaller than viruses and must be seen through an electron magnifying lens wh...

Q: Organic monomers joined to form organic polymers is the stage number evolutionary biologists. of the...

A: Origin of life: Stanley L. Muller and Harold C. Urey first conducted the experiment to show origin o...

Q: IV Study the pedigree above. 1. What type of inheritance pattern is depicted?, 2. If the disease is ...

A: A pedigree chart shows the family members who are affected by a genetic trait by displaying a family...

Q: Why are lymphoid tissues associated with the gastrointestinal tract and respiratory tissues?

A: Introduction :- Lymphoid tissues are well-organized tissues that help the immune system function. Pr...

Q: 1. What are the different glands involved in a semen? 2.  What is the process in the delivery of sp...

A: 1ans) Semen = sperm+accessory glands. *The glands that are involved in a semen are Accessory glands....

Q: Complete the energy pyramid by writing the source of the energy for the food web and how much energy...

A: Introduction An organism's trophic level is the position it holds in a food chain. A food chain is a...

Q: What should be the complementary strand of 3'-ATGGCTTGA-5'? Select one: a. 5'-TACCGAACT-3' b. 3'-TAG...

A: DNA or deoxyribonucleic acid is a double stranded polynucleotide that is present within the nucleus,...

Q: Review of the Anatomy and Physiology of the brain Fil out the table below Section of the brain (fore...

A: Human brain The brain is the central information processing organ of our body and acts as as the 'c...

Q: Which of the following is an accurate model and description of anaphase II in Cape parrots?

A: As per the Karyotype of the somatic cells from the cape parrots obtained, they have total 29 pair of...

Q: J. ach compound on the left with its name on the right. Match the name with the functional E. group ...

A: Functional groups are atoms that bind to an organic molecule's carbon backbone and give certain prop...

Q: The following monomer and polymer is matched: O DNA - Nucleic acid Protein - Enzyme

A: An atom is the smallest component unit of matter that makes up a chemical element. A molecule is a p...

Q: what are the different hoods in the lab and why are they important?

A:

Q: Give a new example of transgenic organism wherein i can generate desired characteristics of that cer...

A: Transgenic organisms can be produced through various mechanisms such as Transformation, Transfection...

Q: Region on the graph that shows that there is a threshold. Effect or Lethal 50% B D Dose (concentrati...

A: The answer for the same is Below- 

Q: Explain characteristics of oomycota? Explain characteristics of mucarales ?

A: Unlike to fund the members of the Phylum oomycota lack chitin in their cell walls and have a life cy...

Q: o What is a pure culture? o Describe the procedure for making a streak plate from a clinical specime...

A: Introduction A growth media, also known as a culture medium, is a solid, liquid, or semi-solid mediu...

Q: The coding DNA strand of a gene has the following DNA sequence: 5' ATGGCGACGATAATGTTGTGTGAGTGA 3' 1)...

A: Central Dogma: It is the complete procedure of replication, transcription, and translation of DNA. T...

Q: Who's is the father of cell biology? And give a little history about him

A: Cell is present in all organism and is a chief elemental unit of the body which is site for various ...

Q: Compare Class Maxillopoda and Class Branchiopoda

A: Arthropoda It is a much heterogeneous group including a variety of animals with divergent views conc...

Q: your own words, please answer the question. It is a fact that insects are widely distributed in any...

A: Insects are the group of organisms belonging to the Phylum Arthropoda. some insects are causative ag...

Q: Describe five strategies that can be used to engineer resistance into crop plants. Which strategy do...

A: Introduction The main unit of study in agroecology is the agroecosystem, which is vaguely defined as...

Q: II. Answer the following: 1. What does NADPH do? 2. In the Krebs cycle, isocitrate releases a molecu...

A: Citric acid cycle is also known as Krebs cycle or tricarboxylic acid cycle. It is the main source of...

Q: Can you answer all the parts to this question regarding fish (please type the answer)   Mammals hav...

A: Fish gills use a design called ‘countercurrent oxygen exchange’ to maximize the amount of oxygen tha...

Q: Illustrate Darwin's explanation of natural selection above using fish, bird, insect, or plant as the...

A: Introduction- Charles Robert darwin was born in Shrewsbury, in Western England.  He spent most of th...

Q: Identify the structures labeled a and b on the figure below. noitesinsgnO In

A: Chip budding is a grafting technique. A chip of wood containing a bud is cut out of scion with desir...

Q: Number of chromosomes in the individual's body cells Cell division error that resulted in trisomy 18...

A: INTRODUCTION A karyotype is a collection of a species' or an individual organism's full set of metap...

Q: embed an image for each type of malformations of the face.   4.       Astomia                     ...

A: Malformations are the result of an infant's skull or facial bones fusing together too soon or in an ...

Q: In which ways does the limb orientation of "advanced" tetrapods differ from that of  "primitive" tet...

A: Tetrapods are the four limbed structure.And these limbs have derived from fins.The limbs of all tetr...

Q: Classify each example under the following characteristics of life (1) gathering and using energy, ...

A: Introduction Regardless of complexity, structure, habitat, or other factors, all living things on Ea...

Q: A. Crossword on Earth's Record of Life Directions: Use the clues to answer the crossword puzzle. The...

A: Fossils are preserved remains of plants and animals whose bodies were buried in sediments. Fossils a...

Q: What are the key features of schizophreniform disorder?

A: Introduction  Schizophrenia is a brain disorder/mental disorder which can occur due to several reaso...

Q: While performing a routine protein crystallization screening, you observe that one of your well drop...

A: Introduction The drop on the elevated platform, which is usually 2–10 µl, consists of half stock pro...

Q: The teacher suggested that the students revise their model to represent individuals who have a heter...

A: The case in which two different alleles can be observed to be associated with a particular gene is r...

Tissue renewal

In multicellular organisms, tissue is a level of structure that consists of a group of physically and functionally identical cells and their intercellular substances. Unicellular organisms do not have tissues. Tissues are absent or poorly differentiated even in the simplest multicellular animals, such as sponges. However, more evolved multicellular animals and plants have specialized tissues that may organize and govern an organism's reaction to its surroundings. The word tissue is derived from the Latin word 'weave.' Plants and animals have various kinds of tissue systems that differ in their work and composition according to the different requirements.