It is possible to "reconstitute" nucleosomes by mixing DNA and his- tone octamers in 2M NaCl and then dialyzing to low salt. When such experiments were carried out using a specific 208-bp fragment of sea urchin DNA, the following results were obtained: Digestion of the product with micrococcal nuclease gave quantitative production of 146-bp DNA. Upon cleavage of this DNA with a restriction nucle- ase having a single site in the fragment, several sharp bands were obtained, with sizes as follows: 29 bp, 39 bp, 107 bp, 117 bp. How would you interpret these data in terms of nucleosome positioning on this DNA?

It is possible to "reconstitute" nucleosomes by mixing DNA and his- tone octamers in 2M NaCl and then dialyzing to low salt. When such experiments were carried out using a specific 208-bp fragment of sea urchin DNA, the following results were obtained: Digestion of the product with micrococcal nuclease gave quantitative production of 146-bp DNA. Upon cleavage of this DNA with a restriction nucle- ase having a single site in the fragment, several sharp bands were obtained, with sizes as follows: 29 bp, 39 bp, 107 bp, 117 bp. How would you interpret these data in terms of nucleosome positioning on this DNA?

Concepts of Biology

1st Edition

ISBN:9781938168116

Author:Samantha Fowler, Rebecca Roush, James Wise

Publisher:Samantha Fowler, Rebecca Roush, James Wise

Chapter9: Molecular Biology

Section: Chapter Questions

Problem 15CTQ: Transcribe and translate the following DNA sequence (nontemplate strand): 5’-ATGGCCGGTTATTAAGCA-3’

See similar textbooks

Similar questions

Reiji and Tuneko Okazaki conducted a now classic experiment in1968 in which they discovered a population of short fragmentssynthesized during DNA replication. They introduced a shortpulse of 3H-thymidine into a culture of E. coli and extracted DNAfrom the cells at various intervals. In analyzing the DNA aftercentrifugation in denaturing gradients, they noticed that as theinterval between the time of 3H-thymidine introduction and thetime of centrifugation increased, the proportion of short strandsdecreased and more labeled DNA was found in larger strands.What would account for this observation?
Do virtual restriction digests of 300ng pGLO plasmid using HinDIII, EcoRI, and XhoI separately, and a double digest of pGLO with HinDIII plus EcoRI. How many nanograms of DNA should we expect to be contained within the slowest bandfrom the HinDIII-digest of pGLO?
Most laboratory strains of E. coli contain site-specific DNA methylases. The methylase encodedby the dam gene (Dam methylase) transfers a methyl group from S-adenosylmethionine (SAM) tothe N6 position of the adenine residues in the sequence GATC. The Dcm methylase (encoded bythe dcm gene) methylates the internal cytosine residues in the sequences CCAGG and CCTGG atthe C5 position.The E. coli strain used in this experiment is mutated so Dcm and Dam methylases are notfunctional. What is the advantage of using dcm or dam mutants when the E. coli will be a host torecombinant DNA? HINT – If the E. coli methylates the DNA in these cells, then how would thisaffect the activity of restriction endonucleases
Richard Boyce and Paul Howard-Flanders conducted an experimentthat provided biochemical evidence that thymine dimers areremoved from DNA by a DNA repair system. In their studies, bacterialDNA was radiolabeled so the amount of radioactivity reflectedthe amount of thymine dimers. The DNA was thensubjected to UV light, causing the formation of thymine dimers. When radioactivity was found in the soluble fraction, thymine dimershad been excised from the DNA by a DNA repair system.But when the radioactivity was in the insoluble fraction, the thyminedimers had been retained within the DNA. The following tableillustrates some of the experimental results involving a normalstrain of E. coli and a mutant strain that was very sensitive to killingby UV light: Explain the results found in this table. Why is the mutant strainsensitive to UV light?
During your experiment you analysed only a few of the recombinant clones for the presence of thehighly repeated Alu elements. If you wanted to screen for a single-copy gene, you would need to screenall of a much larger genomic library. Assuming, that you already know the amino acid sequence ofunicorn (a species with a similar physiology to humans) insulin, how would you construct a probe whichwould enable you to use nucleic acid hybridisation to screen a unicorn genomic DNA library for theinsulin gene? Hint: you have access to any molecular biology reagents and equipment you might need, such as vectors,enzymes, and DNA sequencers.
The restriction endonuclease NotI recognizes the octanucleotide sequence GCGGCCGC. Calculate the expected number of NotI cleavage sites in the bacteriophage λgenome, a linear DNA duplex 48.5 kbp in length with a (G + C) content of 50%.
A 2.0kb bacterial plasmid ‘BS1030’ is digested with the restriction endonuclease Sau3A; the plasmid map is depicted in the diagram below and the Sau3A (S) restriction sites are indicated. Which of the following DNA fragments do you expect to see on an agarose gel when you run Sau3A-digested plasmid ‘BS1030’ DNA? a. 250 bp, 450 bp, 550 bp, 1.1 kb, 1.5 kb and 2.0 kb b. 2.0kb c. 250 bp, 400 bp, 450 bp, 500 bp and 550 bp d. 100 bp, 200 bp, 250 bp, 400 bp, 500 bp and 550 bp
RNA polymeraze binds 100x quicker to the promotor when the promotor is in a 8kb plasmid than to the same promotor on a 200bp linear segment. Assuming that the incubation is performed with equal concentrations of the two types of DNA, explain this difference.
The chain terminator method was used to sequence the following DNA fragment: ACTGGGCATAAGCGGGAACTTTGCAGAACTGGCTGGCCTCAGAGCAGGGA. 1. Predict a band pattern in a gel after sequencing this DNA fragment using a radioactively labeled primer [32P]-5’- TCTGAGGCCAGCCAGTTCTGCAAAGTTC. 2. Due to an experimental mistake, dATP was not added in all four reaction mixtures. How does the band pattern change?
The 3′-exonuclease activity of E. coli DNA polymerase I was found to show no discrimination between correctly and incorrectly base-paired nucleotides at the 3′-terminus; properly and improperly base-paired nucleotides are cleaved at equal rates there. How can this observation be reconciled with the fact that the 3′-exonuclease activity increases the accuracy with which template DNA is copied?
the restriction enzyme NotI recognizes the following sequence : 5'-GCGGCCGC-3' . On average, how oftern should this enzyme cleave DNA?
Homologous recombination in E. coli forms heteroduplex regions of DNA containing mismatched bases. Why are these mismatches not eliminated bythe mismatch repair system?