Look at the structure of the disaccharide shown. Name the type of bond which is present. CH2OH H он он CH2 H он H ÓH ÓH O B - 1, 4- N-glycosidic linkage O a- 1, 4- 0-glycosidic linkage O B- 1, 4-0-glycosidic linkage O a- 1, 6- O-glycosidic linkage O a- 1, 4- N-glycosidic linkage

Q: Only one of the statements below is correct; which one? Two solutions are hypotonic when they have…

A: Here, four statements are given based on osmotic pressure and we have to find out the correct…

Q: Given Sorbitol, Briefly explain its expected reaction (based on their structural formula) to the…

A: Sorbitol is a carbohydrate that is classified as a sugar alcohol or polyol.

Q: What is unique about the use of viral gene therapy in cancer immunotherapy

A: Virus have natural ability of delivering genetic material into the cells. Therefore, some of the…

Q: Given Tagatose, Briefly explain its expected reaction (based on their structural formula) to the…

A: The Molisch's test, Fehling's test, and Bial's test are the qualitative tests for carbohydrates. In…

Q: Which of the following statements best describe testing of lactose sample? Lactose will quickly…

A: Lactose is a reducing sugar made up of 2 units, one is glucose and galactose. It is made up of two…

Q: When do plants usually undergo mitochondrial respiration?

A: Mitochondrial respiration is commonly known as cellular respiration. This is the process of energy…

Q: If the extracellular K* concentration increases to 20 mM, what would be the Nernst Potential of K*…

A: Membrane potential is the voltage difference between inside to outside of the cell. In absence of…

Q: Enzymatic digestion of carbohydrates starts in the mouth.  True  False

A: Enzymatic digestion is generally referred to as the act of breaking down ingested food materials,…

Q: Given a part of DNA undergoing replication. Copy and write the corresponding bases in the new…

A: Semiconservative mode of DNA replication describes the mechanism of DNA replication in all living…

Q: 1. A nucleoside is composed of Sugar and Nucleic Acid-Base. 2. The Nucleic Acid base in DNA and RNA…

A: Statement 1 is FALSE. BECAUSE NUCLEOSIDE IS COMPOSED OF NIYROGEN BASE+ PENTOSE SUGAR, NOT THE…

Q: structures of 2 complex lipids (a) a glycolipid and (b) a sphingolipid. Would either of these…

A: Molybdate solution test: First we need to know what is molybdates solution, and how it works?…

Q: The sucrose substitute tagatose is produced by hydrolyzing lactose and then chemically converting…

A: Introduction: Tagatose is a ketohexose that appears similar in structure to D-fructose, except for…

Q: 3. In what direction (toward the anode, toward the cathode, or toward neither) will the following…

A: As like amino acids, peptides, and proteins include both acidic and basic functional groups. The…

Q: malate + NAD+ oxaloacetate + NADH + H+ If the pH = 7 and [malate] = 0.0010 M, [oxaloacetate] =…

A: Malate + NAD+   →Malate dehydrogenase  Oxaloacetate + NADH + H+ Above reaction is the last step of…

Q: Why in infants idiopathic hypercalcemia occurs?

A: Hypercalcemia is a condition in which there occurs excess calcium in the serum of affected person.…

Q: Substrate A occupies the active site of an enzyme. However, inhibitor XY occupies a region in the…

A: Enzymes are catalyst which only accelarate the reactions but doesn't take part in reaction. So after…

Q: Which of the following statements is CORRECT regarding the following intermediate? H2N H NH2

A: "Since you have asked multiple questions, we will solve the first question for you. If you want a…

Q: Food Sample marshmallows Pumpkin seeds cracker Dried cranberries рорсorn Rice cake almond

A: Calorific value of foods is based on their nutrient content. Calorific value of foods is the total…

Q: lood group A has A antigen on the red blood cells with anti-A antibodies in the plasma. O True O…

A: Introduction: The ABO blood group system is the most common blood type system in human blood…

Q: 1. What are the three major pathways that eventually become entry points of molecules into the Krebs…

A: Hi! Thank you for the question, as per the honor code, we are allowed to answer the first…

Q: Vhich of the following glycerophospholipid has a phosphate ester attached to a sugar moiety? O…

A: Introduction: Glycerophospholipids are the most abundant lipids present in the cell membranes. The…

Q: List the different molecules, an electrons is part of, as it moves from NADPH through the…

A: This is the second phase of photosynthesis , after the light dependent phase. It undertakes CO2…

Q: 10. Isoniazid (MAO inhibitor) is prescribed to the patient with Parkinson discase. What does cause…

A: Parkinson's disease is commonly seen in adults after the age of 50. Parkinson's disease is known to…

Q: 4. Liver alcohol dehydrogenase (LADH) catalyzes a reversible, pH-dependent oxidation of an alcohol…

A: Density=massvolumeDensity of methanol=mass of methanolvolume of methanol0.79 g/ml=mass of…

Q: Which of the following are proper disinfection steps? Check all the O Remove organic matter O…

A: Introduction: Disinfection is substances that are applied to non-living objects to destroy…

Q: Only one of the statements below is correct; which one? Two solutions are hypotonic when they have…

A: The terms isotonic, hypertonic, and hypotonic are typically used to compare the concentration of a…

Q: Using DEAE-cellulose as ion exhange resin, indicate the starting and ending pH for the narrowest…

A: Ion exchange chromatography is used to separate the charged molecules such as amino acids and…

Q: Why is glucose phosphorylated to become glucose-6-phosphate?   Group of answer choices to…

A: Glucose-6-phosphate: It is a glucose sugar that is phosphorylated at the hydroxy group on 6th…

Q: 7. What is the base sequence, specified in the 5' to 3' direction, for a segment of newly formed DNA…

A: The genetic material in most organism is double stranded DNA with the two strands running in…

Q: Hello! Can you help me in determining the statements below if it's true or false? It's all about…

A: Lipids are organic compounds that are insoluble in water and soluble in organic solvents like ether…

Q: Mitochondria are considered to be the powerhouses of eukaryotic cells because they produce ATP,…

A: Citric acid cycle metabolizes acetyl-coA derived from glucose. Fermentation of lactic acid produces…

Q: 4. How does compromised pyruvate kinase activity lead to anemia ?

A: Anemia is a disorder in which the body does not have enough healthy red blood cells to transport…

Q: Illustrate and summarize ketogenesis.

A: Ketogenesis is one of the biochemical pathways. The process of ketogenesis occurs in the liver. The…

Q: In Table 13-1, what is the most common function of proteins that contribute to pattern formation?…

A: Drosophila melanogaster, a fruit fly, is utilised as a model organism in research spanning from…

Q: OH HO NH2 O Cceramide O Sphingosine O Globoside O sphingomyelin

A: Lipid metabolism is the synthesis and degradation of lipids in cells, which includes the breakdown…

Q: 3. Below is the sequence of DNA template for transcribing a segment of mRNA. 5 ATGTGGTTATAGCTAACC 3…

A: In the question, we must write the complementary base of the sequence. Our mRNA sequence will be in…

Q: A mixture of Alanine (pl 6.02), Glutamic Acid (pl 3.22), Glycine (pl 5.79), Lysine (pl 9.74) and…

A: Ion exchange chromatography is used to separate molecules based on their net surface charge.

Q: Using DEAE-cellulose as ion exhange resin, indicate the starting and ending pH for the narrowest…

A: DEAE-cellulose contains an diethylaminoethyl group and is positively charged at neutral pH.

Q: Which organ typically does not use fatty acid oxidation as a source of ATP?     Liver     Brain…

A: Fuel molecules are those biomolecules that upon oxidation yields the body with ATP. Our body uses 4…

Q: How many molecules of NADH are produced if 12 molecules of glucose enter the glycolytic pathway?

A: Glycolysis is a catabolic process which occurs in cytosol.

Q: o) For each of the potential electron acceptors below, determine the following using the class notes…

A: In a chemical reaction, Oxidizing agents are ions or molecules which accept electron and reducing…

Q: Match lipid descriptions in column A with the phospholipid types in column B. H is attached to the…

A: Phospholipids have a glycerol backbone and are the major constituents of the cell membrane.

Q: 4. You prepare a solution of a biopharmaceutical drug candidate. Initially you have a clear…

A: Biopharmaceutical drugs are the drugs prepared from biological sources such as microorganisms, human…

Q: The table below provides kinetic information when ADH is reacted with ethanol alone, NAD+ alone, and…

A: Enzyme kinetics is the study of an enzyme catalyzed biochemical reactions. Usually it is studied by…

Q: Only one of the statements below is correct; which one? O Two solutions are hypotonic when they have…

A: Tonicity is a parameter of the effective osmotic pressure gradient, which is the difference in water…

Q: well-conserved regions in multiple sequence aligmements: a. are areas of structural importance b.…

A: Multiple Sequence Alignment (MSA) is the alignment of three or more comparable length biological…

Q: What other diseases are associated with estraneous forms of hemoglobin subunits in the human adult?

A: Hemoglobin is an oligomeric conjugated protein with four peptide chains joined by a…

Q: Substrate cycling does not violate the laws of thermodynamics in making both directions of a…

A: The study of energy and energy transfer in physical matter is known as thermodynamics. A system is…

Q: temperature of 15 degree Celsius or lower needed for growth / optimal activity. * (Please choose one…

A: A) Thermophiles: Thermo meaning temperature and philus meaning lover , this type of organism which…

Q: 2. An MRNA has a sequence AAAUUACUCGAAAUUGCGUGUAGUS'. DNA, t-RNA and amino acid sequence of the…

A: Given mRNA from 5' to 3' direction: UGAUGUGCGUUAAAGCUCAUUAAA