Using DEAE-cellulose as ion exhange resin, indicate the starting and ending pH for the narrowest experimental pH range used to seperate an amino acid mixture consisting of Gln, Leu and Lys Starting pH: Ending pH:
Q: The molecules of a fatty acid (for example, fit closer together than the molecules of a fatty acid…
A: Fatty acids are composed of a long hydrocarbon chain attached to a carboxylic acid group. Fatty…
Q: What is the terminal electron acceptor in photo- phosphorylation?
A: By activating PSII, photophosphorylation converts ADP into ATP using the energy of sunlight. It…
Q: C17H29COOH linolenic acid non-saponifiable ω-3 fatty acid All are correct
A: Lipids are not polymers. The simplest form of lipid is fatty acids which are a long chain…
Q: TBP is a eukaryotic DNA binding protein that specifically recognizes the Pribnow box. True False
A: Introduction: The TATA box binding protein provides instructions for making a protein called TATA…
Q: Explain the biochemical and subsequent medical consequences of a deficiency of Myoadenylate…
A: Myoadenylate deaminase insufficiency is a metabolic muscle disorder in which the muscle cell's…
Q: Question 17 Which of the following is a fatty acid with this notation, 16:0 O Myristic acid Stearic…
A: In a fatty acid the notation x:y is represented by an integer where x is the number of carbon in the…
Q: Please explain where you would find glycosaminoglycans and what is the importance of these…
A: GAGs are negatively charged linear polysaccharides that are frequently found conjugated with…
Q: 2. An MRNA has a sequence AAAUUACUCGAAAUUGCGUGUAGUS'. DNA, t-RNA and amino acid sequence of the…
A: Given mRNA from 5' to 3' direction: UGAUGUGCGUUAAAGCUCAUUAAA
Q: In a 25 uL reaction, you desire a buffer concentration of 1X. You will be supplied with a stock…
A: Dilution of buffer solution or any solution can be done to obtain a diluted solution with varied…
Q: Explain how energy is invested, stored, and released via chemical reactions
A: Energy is the organism's fundamental requirement. All of an organism's actions require this energy.…
Q: Both reducing monosaccharide and disaccharide give positive result in Barfoed's test. Which of the…
A: Barfoed's test is done to differentiate between monosaccharide and disaccharide.
Q: Question 25 Он HN R Sphingomyelin Phosphocholine ceramide Sphingolipid All are correct
A: Sphingolipids are class lipids with sphingosine as core molecule Sphingomyelins are composed of…
Q: The questions ask you to identify which compounds have a specific functional group. For each…
A: Here all the compounds given are organic compounds with Carbon and hydrogen back bone structure. It…
Q: Select the lipid that does not have any fatty acyl groups in its structure: glycerophospholipid,…
A: Fatty acids are important micromolecules which combine together to form lipids in plants, animals…
Q: 1. A farmer crossed a round-shaped (T) and yellow-colored (Y) seed plant carrying yellow seeds (Y)…
A: Given P1(Parent 1)= Round Shape(T) Yellow Colour (Y) P2(Parent 2)= Wrinkled Shape(t) Green Colour…
Q: QUESTION 5 Using SP-Sepharose as ion exhange resin, indicate the starting and ending pH for the…
A: Note : Hi ! Thank you for the question. We are authorized to answer one question at a time. Since…
Q: Lecithins and cephalins are both
A: Lecithin are mixture of glycerophospholipids like phosphatidylcholine, phosphatidylethanolamine,…
Q: Genetically modifying seeds to produce herbicide-resistant plants that increase crop yields has…
A: A Genetically modified technology is formed of insertion of a DNA into the genome of an organism.…
Q: When [I] is 10-7 M, 99% of P's activity is inhibited. What is the Kd of this Protein- Inhibitor…
A: Protein can function as enzymes, signal molecule, ligand, receptor, etc. Its function can be…
Q: The picture below shows the body's response to acute stress, which is to release adrenaline…
A: Introduction: Adrenergic neurons release norepinephrine as the primary neurotransmitter. These…
Q: 8/9 Instructions; • Answer the Question properly and accordingly. • Do not copy here in Bartleby or…
A: Note : Hi ! Thank you for the question. We are authorized to answer one question at a time. Since…
Q: a. What is isoelectric point? (Round your answer to two decimal places, for example: 0.13 or 1.45 or…
A: The isoelectric point (pI) is the pH at which a particular molecule carries no net electrical…
Q: Question 12 C17H29COOH O linolenic acid O non-saponifiable O w-3 fatty acid O All are correct
A: C17H29COOH - It has double bonds at 9, 12, 15th carbon position
Q: When specific conditions are met, the creation of peptide bonds rather than the hydrolysis of…
A: Proteins are unbranched polymers constructed from 20 standard α-amino acids. They have four levels…
Q: Which of the following is a fatty acid with this notation, 16:0 Stearic acid Myristic…
A: Fatty acids are important micromolecules which combine together to form lipids in plants, animals…
Q: What might be the dangers in using supplements to get DHA in your diet?
A: Docosahexaenoic acid (DHA) is an omega-3 fatty acid found in cold-water fish like tuna and salmon,…
Q: what molecules can prevent anabolic steriods form working?
A: Anabolic steroids are also known as anabolic adronergic steroid.This are binds to androgen receptors…
Q: Which of the following is/are incorrect? - All proteins are polymeric - Not all nucleic acids are…
A: A biomolecule, also called a biological molecule, is a chemical compound found in living organisms.…
Q: Question 4 Match the each enzyme deficiency with their corresponding disease B-hexosaminidase A A.…
A: Enzyme deficiency results in certain metabolic disorders and results in serious diseases.
Q: ruvate through the TCA cycle. calculate the net ATPS produced from one olecule of alucose in a…
A: Oxidation of glucose molecule through a combined action of glycolysis , the TCA cycle , and…
Q: In plants, under what solution conditions are Calvin cycle and gluconeogenesis enzymes most active?…
A: Gluconeogenesis is the process of Synthesis of glucose from non Carbohydrate sources like aminoacids…
Q: Identify the ff nucleic acid bases and then classify whether it is a purine or pyrimidine.
A: Nucleic acids are also known as polynucleotides. Monomeric units of nucleic acids are called…
Q: What are the main structural features of an amino acid?
A: Amino acids are compounds containing carbon, hydrogen, oxygen and nitrogen. They serves as building…
Q: 1. DNA replication is described as semi-conservative because A. one leading strand and one lagging…
A: Hi! Thank you for the question, as per the honor code, we are allowed to answer the first 3…
Q: LIPIDS Functions Chemical Components 1. 1. 2. Two Primary Categories of Lipids 2. 3. 3 4. Two…
A: Functions of lipids: 1. Storage of energy 2. Transmit nerve impulses 3. Structure of cell membranes…
Q: Assume the energy of hydrogen bonds per base pair to be 5.86 kJ-mol-1. Given two complementary…
A: Given Energy of H-Bond per base pair = 5.86 kJ mol-1 Number of Base pair in complementary DNA = 145…
Q: Which of the following statements about cancer is false? (a) oncogenes arise from mutations in…
A: Proto Oncogenes are the genes that cause cancer when get altered. There are several factors that…
Q: 3. In what direction (toward the anode, toward the cathode, or toward neither) will the following…
A: As like amino acids, peptides, and proteins include both acidic and basic functional groups. The…
Q: Calculate the standard free-energy change, deltaG°, for the reaction in which acetaldehyde is…
A: Standard free energy of biochemical reaction is related to standard reduction potential ∆Go = -nFEo…
Q: Derive the amino acid sequence that is coded for by each of the following mRNA sequence. 5' CAA…
A: Amino acid are molecules which are combine to form a protein molecules.Amino acid are synthesized by…
Q: Only one of the statements below is correct; which one? Two solutions are hypotonic when they have…
A: Tonicity is a parameter of the effective osmotic pressure gradient, which is the difference in water…
Q: Second messenger in regulation of metabolism is: Select one: O a. hormones Оb. АТР neurotransmitters…
A: Secondary Messengers are the molecules that act as amplifying components in the cell signalling and…
Q: Glucose are stored in the form of glycogen and any excess will be stored in the form of…
A: Glycogen is multibranched polymers of glucose and it is storage form of carbohydrates in mammals.…
Q: 4. Complete the table below: RNA DNA Strand Sugar residue Nitrogenous bases Main Function
A: Nucleic acids are made up of nucleotides, which are the fundamental building blocks of DNA and RNA.…
Q: Н Но H OH HO, OH H HN- a. Glucocerebroside CH3 OH H3C -N-CH,- CH2-0-P-01 HN CH3 b. Sphingomyelin
A: Glucocerebrosides are lipid derivatives composed of sphingosine, fatty acid and a glucose residue.…
Q: Retroviruses, like the HIV, contain an enzyme called reverse transcriptase. Explain the flow of…
A: Introduction: In retrovirus, RNA is used as genetic material. It uses the enzyme…
Q: II. Effect of temperature Observation(Time taken for the disappearance of blue-black colour) Test…
A: Introduction: Enzymes are organic biocatalysts that fasten the rate of chemical reaction that is…
Q: Given Ribose, Briefly explain its expected reaction (based on their structural formula) to the…
A: Ribose is a simple sugar and carbohydrate. Ribose, also called D-ribose is a five-carbon sugar found…
Q: Some enzymes can be inhibited by high concentrations of their substrates. I expression for the rate…
A: In the biological systems , enzymes acts as catalysts . Enzyme help to accelerate the reactions.…
Q: The glycerol-3-phosphate shuttle can transport cytosolic NADH equivalents into the mitochondrial…
A: Note : Hi ! Thank you for the question. We are authorized to answer one question at a time. Since…
Step by step
Solved in 3 steps with 1 images
- Using DEAE-cellulose as ion exchange resin, indicate the starting and ending pH for the narrowest experimental pH range used to separate an amino acid mixture consisting of Gln, Leu and Lys Starting pH: _____ Ending pH: _____Solution Absorbance mg/ml aspirin Standard solution - 1.6 mg/mL A 0.638 0.08 mg/mL B 0.504 0.064 mg/mL C 0.376 0.048 mg/mL D 0.259 0.032 mg/mL E 0.126 0.016 mg/mL A = -log T where T = %T ÷ 100 Construct a callibration curve using the above data. Absorbance should be on the vertical axis and "mg/mL of acetylsalicylic acid" on the horizontal axis. The line should go through the origin. Using the data provided, the graph you have generated, and the procedure that was used to generate the solutions which were examined by spectroscopy, calculate the amount of acetylsalicylic acid per tablet. Commercial tablet 1 labelled as 100 mg enteric coated Absorbance = 0.16 Commercial tablet 2 labelled as 300 mg Absorbance = 0.45 Student prepared tablet from practical 5 Absorbance = 0.19 Using the data provided, the graph you have generated, and the procedure that was used…Complete the table below regarding the different laboratory tests done for Amino Acids and Proteins Tests Procedure (Chemical Reagents Added) Positive Results/ Observations (ex: color of solution, precipitate formation, etc) Positive for (provide details like functional group responsible) Molisch Test Benedict’s Test Barfoed’s Test Moore’s Test Bial’s Test Seliwanoff’s Test Osazone Test Fehling’s Test Tollen’s Test Mucic Acid Test Lugol’s Test/ Iodine Test Hydrolysis w/ Benedict’s Test Hydrolysis w/ Iodine Test Provide the expected results with the samples given below: For negative results just leave it blank, for positive results write “(+) then the expected observation” ex: + blue solution Samples Molisch Test Benedict’s Test Barfoed’s Test Moore’s Test Bial’s Test Seliwanoff’s Test Glucose Galactose Fructose Ribose…