well-conserved regions in multiple sequence aligmements: a. are areas of structural importance b. are areas of both functional and structural importance c. are likely to be areas of functional and/or structural importance d. are areas of functional importance
Q: Why does it make sense that under conditions of low ATP levels in the cell the pyruvate carboxylase…
A: Glucose is converted to pyruvate through the process of glycolysis in the cytoplasm. The process of…
Q: If the extracellular K* concentration increases to 20 mM, what would be the Nernst Potential of K*…
A: Membrane potential is the voltage difference between inside to outside of the cell. In absence of…
Q: ins that mady De (A) constitutive proteins B B isoforms C spliceosomes
A: Proteins are composed of amino acids, which are bound together by peptide linkage. Amino acids…
Q: Which of the following is/are incorrect? - All proteins are polymeric - Not all nucleic acids are…
A: A biomolecule, also called a biological molecule, is a chemical compound found in living organisms.…
Q: 7. Which of the following statement is true? A. oxidative rancidity is observed more frequently in…
A: Introduction: Rancidity is the development of unpleasant smells in fats and oils that is often…
Q: For each of the tripeptide: Tyrosylisoleucylleucine Methionylcysteinylisoleucine 1. Draw the…
A: An amino group and an acid group-containing organic molecules are called Amino acids.…
Q: Question 17 In a glucometer, glucose oxidase catalyzes the redox reaction of glucose to form…
A: Glucometer is the instrument used to measure and display the amount of glucose level in the blood.…
Q: Competitive inhibitors are: Select one: O a. bind to another part b. causing the enzyme t bind to…
A: Inhibitors are molecules that bind to enzyme and block it's activity. Enzymes inhibitors are…
Q: Choose the wrong, Release of energy (ATP) comes from the Select one: O a. when the terminal…
A: ATP is the energy currency of the cell.
Q: Usually found in prokaryotes, regulatory sequences lying adjacent to the DNA being transcribed are…
A: In prokaryotes, the process of transcription and translation occur simultaneously due to the lack of…
Q: 5' 3' For numbers 6 to 10, refer to the image above and answer the questions. 6. Which among the two…
A: Hi! Thanks for your question. As you have posted multiple questions and have not mentioned which one…
Q: 2. (: A diagram of the residues defining the binding site of 2,3-bis-phosphoglycerate (BPG) is shown…
A: 2,3 bis phosphoglycerate (BPG) is an allosteric regulator of Hb. BPG binds to central cavity of…
Q: Substrate 1 Site A Nonpolar Polar and neutral Polar and Site D Site B Polar and neutral Acidic…
A: Enzymes are usually composed of proteins and it catalyzes biochemical reactions in our body. It is…
Q: In Table 13-1, what is the most common function of proteins that contribute to pattern formation?…
A: Drosophila melanogaster, a fruit fly, is utilised as a model organism in research spanning from…
Q: 1) If a mutation caused an alanine to turn in glycine, what kind of effect do you think that would…
A: Alanine: An aliphatic amino acid with methyl (-CH3) group side chain and is non-reactive side chain…
Q: 1. Consider the fatty acid C24:3 (D10, 13, 16) Break down this fatty acid. Show all the products…
A: The given fatty acid is C24:3 (D10, 13, 16) has 24 C-atom chain with three unsaturation in between…
Q: 18:1c∆9 ω-9 fatty acid oleic acid both are correct neither is correct
A: In plants, animals, and microbes, fatty acid is a key component of lipids (fat-soluble components of…
Q: Unsaturated fatty acids are commonly esterified at the hydroxyl substituent of glycerol at what…
A: Glycerol : It has 3 hydroxyl groups that get esterified with 1,2 or 3 fatty acids giving…
Q: ion. What cause mentioned changes? For the
A: Amino acids are building blocks of proteins which can be divided into two group based on its…
Q: Maintaining blood glucose levels above 40 mg/dL is important so that all cells are able to take in…
A: Glycogen is a polymer with a branching structure. Carbohydrates are stored in this form in the human…
Q: 12. Polenske value of fatty acid indicates A. how much unsaturation is there in the fatty acid B.…
A: Volatile fatty acid : Linear small(short chain) aliphatic mono-carboxylate compound, like the acetic…
Q: Which of the following WILL PROMOTE sol formation of neutral polysaccharide sample? a. place the…
A: Polysaccharides are used for hydrogel formation nowadays which is diversely used in the field of…
Q: Which of the following statements regarding the structure of DNA inside cells is NOT correct? A.…
A: DNA : Double helix A: Adenine G: Guanine T: Thymine C : Cytosine
Q: CHALLENGE QUESTION I: Smurf hemoglobin has a p50 of 30 torr and has 8 subunits, instead of the usual…
A: Fractional saturation(Y) is the ratio of concentration of protein-ligand complex to total…
Q: The portion (the C-terminal end) of original substrate with the new amino terminus diffuses away.…
A: Introduction: Enzymes have a spectacular ability to accelerate the rate of a chemical reaction.…
Q: Derive the amino acid sequence that is coded for by each of the following mRNA sequence. 5' CAA…
A: Amino acid are molecules which are combine to form a protein molecules.Amino acid are synthesized by…
Q: Prompts Submitted Answers Eukaryotic rRNA genes are transcribed and Choose a match processed in the…
A: 1. Eukaryotic rRNA genes are transcribed and processed in the :- NUCLEOLUS.
Q: 14. Naturally occurring fats are A. L types B. D types C. an equi-molar mixture of L and D types D.…
A: Fat is often used in nutrition, biology, and chemistry to refer to any ester of fatty acids or a…
Q: Draw the Fischer projection formula for each sugar and give the importance/use of each. D-…
A: The monosaccharides are required to form oligo and polysacharides. Monosaccharides may be aldoses or…
Q: What is the flow of genetic information?
A: The flow of genetic information is always unidirectional. It is depicted in central dogma…
Q: Compare and contrast the de novo synthesis of purine and pyrimidine ribonucleotides. Move each…
A: There are two biosynthetic pathways for the synthesis of nucleotides: De novo pathway: The bases are…
Q: Match the following descriptions to the given choices Synthesized from a steroid molecule A. Vitamin…
A: Vitamin is an organic substance and an essential micronutrient that an organism needs in small…
Q: Acetyt CoA Oxaloscetate CoA NADH Citrate NAD Isocitrate Malste Pumarate NAD NADH FADH, FAD a-…
A: TCA cycle is the tricarboxylic acid cycle which is second step in cellular respiration that occurs…
Q: Please explain where you would find glycosaminoglycans and what is the importance of these…
A: GAGs are negatively charged linear polysaccharides that are frequently found conjugated with…
Q: Transcription of a typical gene encoding a polypeptide in eukaryotes involves all of the following…
A: In eukaryotes, the genomic DNA is present in the nucleus. The process of transcription in the case…
Q: When can we say that it is an essential amino acids and non essential amino acid? Choose two amino…
A: Introduction: Amino acids are biomolecules that contain an amino and a carboxyl group-containing a…
Q: he figure shows that the average distance between base pairs measured parallel to the axis of a DNA…
A: The nucleic acid polymer has nucleotide as its monomeric unit. synthesis of nucleotides is an…
Q: Explain the enzymes.
A: Enzyme, a molecule that works as a catalyst in living organisms, regulating the pace at which…
Q: What is the most common type of DNA sequence present in eukaryotic genomes? A. Repetitive DNA…
A: B. Minisatellites - Micro- and mini-satellites, as well as satellite DNA sequences, account for…
Q: malate + NAD+ oxaloacetate + NADH + H+ If the pH = 7 and [malate] = 0.0010 M, [oxaloacetate] =…
A: Malate + NAD+ →Malate dehydrogenase Oxaloacetate + NADH + H+ Above reaction is the last step of…
Q: Match lipid structures in column A with its lipid type in column B esters of fatty acids with long…
A: The question include match the following with different options. The correct options are mentioned…
Q: In generating CO2, how can the citric acid cycle discriminate between the carbons in citrate given…
A: In the first phase of the citric acid cycle, acetyl CoA combines with oxaloacetate, a four-carbon…
Q: LIPIDS Functions Chemical Components 1. 1. 2. Two Primary Categories of Lipids 2. 3. 3 4. Two…
A: Functions of lipids: 1. Storage of energy 2. Transmit nerve impulses 3. Structure of cell membranes…
Q: Substrate cycling does not violate the laws of thermodynamics in making both directions of a…
A: The study of energy and energy transfer in physical matter is known as thermodynamics. A system is…
Q: Question 8 Which of the following glycosidic linkages is hydrolyzed by the a-amylase? O a(1,2) O…
A: Amylase:- enzyme that hydrolyse starch.
Q: 1. What are the three major pathways that eventually become entry points of molecules into the Krebs…
A: Hi! Thank you for the question, as per the honor code, we are allowed to answer the first…
Q: does HEW have a higher concentration of negatively/neutral charged protein (at ph 7) explain ur…
A: HEW ( hen egg white) is an enzyme specifically known for its ability to degrade the polysaccharide…
Q: Question 8 O alpa-palmitoyl-beta-stearoyl-alpha-oleoyl glycerol O…
A: Triacylglycerols (TAGs) are the stored form of lipids, which are composed of three fatty acids and a…
Q: Is there a possibility that our body is too much of amino acid? If there is, what are the…
A: Introduction: Amino acids are biomolecules that contain an amino and a carboxyl group along with a…
Q: Question 5 CH3(CH2)14–Ċ-0–CH2-(CH2)28-CH3 Palmitic acid Triacontanol
A: Lipids are a class of biomolecules that are mostly dissolved in organic solvent and contains a…
well-conserved regions in multiple sequence aligmements:
a. are areas of structural importance
b. are areas of both functional and structural importance
c. are likely to be areas of functional and/or structural importance
d. are areas of functional importance
Step by step
Solved in 3 steps
- When comparing (i.e., aligning) two or more genetic sequences, itis sometimes necessary to put in gaps. Explain why. Discuss twochanges (i.e., two types of mutations) that could happen during theevolution of homologous genes that would explain the occurrenceof gaps in a multiple-sequence alignment.The goal of structural proteomics project isa) To crystallize and determine the structure of as many proteins as possible, in many cases with little or no existing information about protein functionb) To identify and sequence of all the genes present in the human bodyc) To introduce new genes to human beingsd) To remove disease causing genes from humansExplain the statement "In a comparison between the DNAS of related organisms such as humans and mice, identifying the conserved DNA sequences facilitates the search for functionally important regions" is true or false.
- Briefly explain (1) the structure characteristics of DNA, (2) why different DNA molecules (i.e., with different sequences) could adopt the same B-form double helical structure, and (3) how certain proteins could recognize the specific sequences with the common B-form DNA.Which of the sequences below do you think would most likely be found in an intrinsically disordered protein? GSSKSSKKREPS MVLITTEVKAT MVLITTEVIIAA All of these could be found in an intrinsically disordered proteinThe goal of many computer programs is to identify sequence elementswithin a long segment of DNA. What is a sequence element? Givetwo examples. How is the specific sequence of a sequence elementdetermined? In other words, is it determined by the computer programor by genetic studies? Explain.
- Consider the problem of searching for genes in DNA sequences using Hor-spool’s algorithm. ADNA sequence is represented by a text on the alphabet {A, C, G, T}, and the gene or gene segment is the pattern. a. Construct the shift table for the following gene segment of your chromo-some 10: TCCTATTCTT b. Apply Horspool’s algorithm to locate the above pattern in the following DNA sequence: TTATAGATCTCGTATTCTTTTATAGATCTCCTATTCTTExplain why similarities between protein sequences (orbetween DNA sequences) can be used as a measure of relativerelatedness.The BLAST program is a tool fora. inserting many DNA fragments into a cell at the same time.b. translating a DNA sequence into an amino acid sequence.c. identifying homology between a selected sequence and geneticsequences in databases.d. all of the above.e. both b and c.
- central dogma of molecular biology describe the flow of information in the cell.There are also exceptions to the central dogma. Which of the following examples is inconsistent with the flow of genetic information in the cell? a. from DNA to mRNA b.from mRNA to protien c.from protien to DNA d.from DNA to rRNA e. from DNA to tRNAWhich pair of sequences demonstrate the strongest case of "excess similarity"? a) Two nucleotide sequences that match at 20% of the sites b) Two amino acid sequences that match at 20% of the sites c) Two sequences of 200 amino acids each that match at 10 sites d) Two sequences of 100 nucleotides each that match at 25 sitesExplain how a multiple sequence alignment can identify functional sites in a genetic sequence.