Ⓒ Macmillan Learning Identify sequence of target gene Verify absence of target gene by PCR Answer Bank verify the PCR insert was not inserted randomly into the genome homologous recombination incorporates the PCR insert in place of the target gene induce cells to take up the PCR product select for the cells that contain the selectable marker use PCR to generate a DNA fragment that contains a selectable marker flanked by the target gene sequence at the 3' and 5' ends

Ⓒ Macmillan Learning Identify sequence of target gene Verify absence of target gene by PCR Answer Bank verify the PCR insert was not inserted randomly into the genome homologous recombination incorporates the PCR insert in place of the target gene induce cells to take up the PCR product select for the cells that contain the selectable marker use PCR to generate a DNA fragment that contains a selectable marker flanked by the target gene sequence at the 3' and 5' ends

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter18: Dna Technologies: Making And Using Genetically Altered Organisms, And Other Applications

Section: Chapter Questions

Problem 9TYK

See similar textbooks

Similar questions

9. During nucleic acid hybridization, the probe is labelled for DNA stability to increase probe-test DNA binding to identify the location of probe and the test DNA binding for amplification 11. What is not true for Sequence tagged site (STS) markers: cannot be mapped by fluorescence in situ hybridization (FISH) subset of STS markers are known as expressed sequence tag (EST) markers can readily be screened by a PCR assay short DNA sequences that occur at a unique location in the genome
Select all that apply: Which of these components must be added to a PCR reaction for it to produce a product?O DNA PrimersO Buffers- dNTPsO RNA PrimersO NTPSO PrimaseO Template DNAO Taq DNA Polymerase
As you learned in this chapter,restriction enzymes are sophisticated“scissors” that geneticistsand molecular biologists routinelyuse to cut DNA for recombinant DNAexperiments. A wide variety of onlinetools assist scientists working with restrictionenzymes and manipulating recombinantDNA for different applications. Herewe explore Webcutter and Primer3, twosites that make recombinant DNA experimentsmuch easier.Exercise I – Creating a RestrictionMap in WebcutterSuppose you had cloned and sequenceda gene and you wanted to design a probeapproximately 600 bp long that could beused to analyze expression of this gene indifferent human tissues by Northern blotanalysis. Internet sites such as Webcuttermake it relatively easy to design experimentsfor manipulating recombinant DNA.In this exercise, you will use Webcutter tocreate a restriction map of human DNAwith the enzymes EcoRI, BamHI, and PstI.1. Access Webcutter at http://www.firstmarket.com/cutter/cut2.html.Go to the Study Area for…
Why is it important to sequence positive clones derived from PCR cloning? Group of answer choices Errors could have been incorporated during restriction enzyme digestion and so it is important to verify that only the expected protein is produced. Errors could have been incorporated during plasmid DNA extraction and so it is important to verify that only the expected protein is produced. Errors could have been incorporated during PCR and so it is important to verify that only the expected protein is produced. Errors could have been incorporated during cloning and so it is important to verify that only the expected protein is produced.
Examine the DNA fragment sequence below. Your job is to design primers for PCR that would be able to amplify this DNA fragment. Design the primers so that they are 7 bases in length. Don’t forget to indicate direction (polarity) of the primers. Also describe where the primer would bind (i.e. top or bottom strand, left or right side of the DNA strand). Please organize your response so that each primer, and associated information, is separated by at least one blank line 5’ - TCCACTTGCTGTGTAGCTAAATCATATAACAG3’ - AGGTGAACGACACATCGATTTAGTATATTGAC
3A.Below are a few (of the many) possible errors that could adversely affect PCR or analysis of PCR products. Explain why these errors are bad and predict if the error would lead to no product or just a low yield. i) Primer and DNA volumes reversed (2.5 µl primer and 22.5 µl cheek DNA) ii) Student is homozygous for a mutation that deletes the four bases that would normally anneal to the last four bases at the 3´end of the primer iii) The PCR tube was not capped tightly (prior to the tube being placed in the thermal cycler) iv) While preparing a sample of the PTC PCR reaction to run on a gel, you intend to pipet up 8 µl of FD1 loading dye, but inadvertently depress the pipet plunger to the second stop instead of the first stop. How would this pipetting error affect your conclusions from the Flash Gel? Note: the error was made while preparing the sample with dye not while loading the gel.
13. Technique whereby inserting DNA into a clone is accomplished using two different restriction enzymes Group of answer choices Primer Walking Positional Cloning Directional Cloning Chromosome Walking
1. What happens in the denaturing step of PCR? A. What happens during the annealing step of PCR? B. What happens during the extension step of PCR? C. What temperatures is associated with each PCR step? D. Why is it necessary to have a primer on each side of the DNA segment to be amplified? (Hint: draw it out to see what happens with only one primer). E. How did the Taq DNA polymerase acquire its name? F. Why are there nucleotides (A, T, G, C) in the master mix? What are the other components of the master mix and what are their functions?
Describe PCR condition to amplify the sequence described Q.No.1 (Select a gene of interest and do BLAST search, and describe results in details.) using primers developed in Q. No. 2 (Design the primers from the sequence used in Q.No.1 and describe its properties in detain showing suitability of primer.)
Look at each PCR component listed below. For each one, determine which steps(s) of the PCR reaction (denaturation, annealing or extension) would be directly affect if that component were missing. Taq polymerase: Oligonucleotide primers: DNA template: Deoxynucleotides (A, T, G and C): Imagine that you correctly prepare your PCR reaction mixture, but there is something wrong with the thermal cycler. Describe what would happen if: The thermal cycler was stuck on 940C: The thermal cycler cycled between 600C and 720C, but never reached 940C The thermal cycler cycled between 940C and 720C, but never reached 600
Examine the DNA sequence shown below. You have been tasked with designing Primers for PCR amplification of the whole fragment shown. Your colleague said that she would design one primer and came up with this sequence – 5’ TGCTATC 3’. You, being a good scientist, need to confirm that her work is good. Where will this primer bind on the target DNA? 5’ CGATGCAATCGAGCTATGGCATATCATAAGCGATAGACAGATAGCA 3’ GCTACGTTAGCTCGATACCGTATAGTATTCGCTATCTGTCTATCGT a. This primer cannot be used in the PCR process. b. It will bind to the top strand on the left side of the fragment. c. It will bind to the bottom strand on the left side of the fragment. d. It will bind to the bottom strand on the right side of the fragment. e. It will bind to the top strand on the right side of the fragment.
Match the method with the appropriate enzyme. _____ PCR a. Taq polymerase _____ cutting DNA b. DNA ligase _____ cDNA synthesis c. reverse transcriptase _____ DNA sequencing d. restriction enzyme _____ pasting DNA e. DNA polymerase (not Taq)