mass

Q: 5.50 Label each stereogenic center as R or S. O HN H d. но е. g. "OH h. H,N 1.

A:

Q: 6. A 30-m vertical column of fluid (p = 1878 kg/m³) is located where g = 9.65 m/s². Find the pressur...

A:

Q: How much salt is needed to produce a 0.9% salt solution with 3.0 kg of water? 90 grams 54 grams 27 g...

A:

Q: mass

A:

Q: - mass, in an

A:

Q: 1. How many mL of 0.250 N TI3* is needed to react quantitatively with 10.00 mL of 0.175 M Sn*. The r...

A: Normality = n × molarity  Where n= number of electrons transferred.  Note: As per our company guidel...

Q: Identify the functional groups in the following molecules. (Use names from the table below. List eac...

A: Given : We have to identify functional groups in the given molecules.

Q: When the compound I is replaced by compound II for anti-fungal activity, it was found that II has le...

A: A multiple choice question based on biological importance of chemicals that is to be accomplished.

Q: Draw the structure of copper-cotton polymer complex and the chemical structure of cotton wool

A: Copper-cotton polymer complex consists of copper nanoparticles which are linked to cellulosic chains...

Q: A 0.5000-g sample which contains both barium and lead is analyzed as follows.. The metals are precip...

A: Given: Mass of Ba and Pb sample = 0.5000 g. Mass of sulfates precipitates formed = 0.1950 g. And mas...

Q: pressune wc 45°C

A:

Q: Calculate the melting temperature (TM) for the GFP primer- CATGGTCCTGCTGGAGTTCGTG (please give clea...

A: The formula for calculating melting temperature for primers is as follows: Tm=2×A+T+4×G+CoC............

Q: 2.38 Give the IUPAC name for each of the following compounds: (a) CH3 (CH2)25 CH3 (b) (CH3)2СHCH(CH)...

A: Dear student I cannot answer other subparts as it it is not in consonace with bartleby guidelines.If...

Q: empirical formula of

A:

Q: The temperature at which the pressure of the vapor on top of a liquid is equal to the external press...

A: Ans : option d Boiling point is the answer.

Q: What is the pH of the solution containing 0.25 M NH 3 and 0.09 M NH4C1? ; pka = 9.25 (Show your solu...

A:

Q: Why does structure formation in nature rely occur on the nanoscale?

A: In this question we have to select one option according to structure formation in nature rely occur ...

Q: Silver crystallizes in a cubic system and the edge of the unit cell is 408 pm. The density of the Ag...

A:

Q: If a laboratory analysis of the mineral aegirine yields 10.0% Na, 24.2% Fe, 24.3% Si, and 41.5% O, w...

A:

Q: Calculate the Molarity when 123.6 g Sodium Hydroxide (NaOH) is dissolved in a 2,172 mL solution.

A: Molarity can be defined as the number of moles of solute dissolved per litre of solution. It is a co...

Q: What is the IUPQC name of this compound (CH3)3CCH2CH2CH(CH3)2

A: IUPAC naming of branched chain alkanes has some important rules to keep in mind . FIrstly we have to...

Q: An experiment using the reaction below produces 33.16 grams of chlorine gas (Cl2). What mass of HF i...

A: Hydrogen chloride reacts with fluorine to form hydrogen fluoride and chlorine. The equation for the ...

Q: I. Write an equation for the proton transfer reaction that occurs when each of the following bases r...

A: Introduction :  Protonation is the process of addition of the hydrogen cation to a compound, general...

Q: Propane is a common fuel used in portable stoves. If a gas canister contains 0.283 dm3 of propane, w...

A: Given, C3H8 (g) + 5 O2 (g) ➝ 3 CO2 (g) + 4 H2O (g)              ∆H = -2221KJ/mol Here, (-) sign indi...

Q: What are the predicted products for the reaction shown? H3O* H

A:

Q: How many of the following nuclei have a nuclear spin and are NMR active? 12с 13с 14N 15N 2H Periodic...

A: The nuclei which has nuclear spin are 13C 14N 15N 2H.

Q: The system releases 121 J of energy while 113 J of work was done on it * Calculate the change in ene...

A: We know that, Work is nothing but different form of energy. If work done by the the system then it r...

Q: held surrounding the sunken ship. Calculate the pressure in atmospheres and pounds per square inch e...

A: Given Depth , d = 12607ft = 3842.613m   To calculate = Pressure The pressure experienced is because ...

Q: 1,850 J is absorbed by 0.65 kg of gold (0.128 J/g•˚C) to a temperature of 78.4˚C: 112.33˚C 100.64˚C ...

A: Heat is given by, Heat(q) = m.s.■T Where, m = mass of substance  s = specific heat capacity  □T = Te...

Q: You have 30.00 mL of a 0.250 M aqueous solution of the weak base (CH3)2NH (Kb= 7.40 x 10-4). This so...

A: Given,  Molarity of weak base, (CH3)2NH = 0.250 M  Volume of (CH3)2NH = 30.00 mL  Base dissociation ...

Q: A combustion analysis of a 0.503 g sample of an unknown hydrocarbon yields 1.53 g CO and 0.756 g HO....

A: Please find your solution below : Empirical formula of a compound is a formula that shows the simple...

Q: H,C CH, CH, CH, HO. CH,

A: Given structure of vitamin A is :   Identify (BOX) Vitamin A functional groups that contribute to ...

Q: 1. Calculate the net energy of Ca2+ and S²- with an inter-atomic separation distance of 1.793nm, if ...

A: To calculate the net energy of ca 2+ and S2- we have to find the lattice energy. So, the charge in b...

Q: OH 10) Т. NANE THE FF. ) CH, CH CH, CH CH3 CH3 OH 2) CH, CEC CH CH, CH, OH CH, CH= CH CH, CH CH OH 3...

A:

Q: Many snack foods have a high percentage of fat. It is the fat content that allows you to burn them u...

A: A question based on biological importance of chemical elements that is to be accomplished.

Q: 30 ml of a 0.4375 M HCl solution are added to 35 ml of 0.250 NaOH solution. What is the final pH ?

A: given :-  molarity of HCl solution = 0.4375 M  volume of HCl solution = 30 mL  molarity of NaOH solu...

Q: 2.25 A certain hydrocarbon has a molecular formula of C5 Hg. Which of the following is not a structu...

A: Cycloalkane can be defined as the hydrocarbon containing carbon bonds bonded by single bonds in a cy...

Q: 27. Explain why in this reaction an increase in temperature does not cause a different product to fo...

A: Resonance  occurs at high Temperature  due to which the Resulting Product is same as given Product.

Q: Ethanol (C2H5OH) burns in air according to the equation: C2H5OH + 302 > 2002 + 3H20 Determine the vo...

A:

Q: internal energy at constant volume process

A: In this question we have to find which statement is correct or which is not . Also we have to know b...

Q: When would you avogrado’s number?

A: Given: Avogadro's number.  

Q: 6. What is the solubility of TICls) in a 0.0168 M NaCI solution? (Kp = 1.7 x1 04 ) %3D

A: [ NaCl ] = 0.0168 M  Solubility product of TlCl, Ksp = 1.7 × 10-4  We need to find solubility. 

Q: Indicate whether the following will increase, decrease, or have no effect on the calculated atomic w...

A: Heat lost by hot water is equal to the sum of the heat gained by the metal and the calorimeter. Acco...

Q: Draw the structures for the following haloalkanes. a. 3-bromo-2-methylpentane b. 1-fluoro-3-methylcy...

A: Since you have posted multiple questions we per guidelines we can solve only one per session . If yo...

Q: How much heat is absorbed by the surrounding if it does 43 J of work, decreasing the energy of the s...

A:

Q: 1. Given the following reduction potentials: Agʻ(aq) + e → Ag(s) Zn? (aq) + 2e Zn(s) Calculate the c...

A: "Since you have asked multiple questions, we will solve the first question for you. If you want any ...

Q: Describe each highlighted bond in terms of the overlap of atomic orbitals. (If the highlighted bond ...

A:

Q: At 100 ⁰C and 5 atm, enthalpy symbol is ΔH⁰ For TCE's of ΔHc, it is necessary that the product is 1 ...

A: At 100 ⁰C and 5 atm, enthalpy symbol is ΔH⁰. This statement is True. For TCE's of ΔHc, it is necess...

Q: A Сopper Zinc Brass Glycine Helium D E F Mercury Saline Ammonia H Hydrogen peroxide Propane Platinum

A: Here we see brass is in face centered cubic unit cell (FCC). And most important it is in solid state...

Q: solubility of oz

A:

Atoms and Molecules

An atom is the smallest unit of an element that possesses all the properties of that particular element. Molecules are the smallest unit of a substance that possess all the properties of that particular substance.