Match the steps of transcription and translation to the location they take place within a eukaryotic cell. RNA splicing [ Choose ] pairing of codons [ Choose ] and anticodons recognition of a [ Choose ] promoter gene construction of [ Choose ] an MRNA molecule formation of the [ Choose ] bond between amino acids

Match the steps of transcription and translation to the location they take place within a eukaryotic cell. RNA splicing [ Choose ] pairing of codons [ Choose ] and anticodons recognition of a [ Choose ] promoter gene construction of [ Choose ] an MRNA molecule formation of the [ Choose ] bond between amino acids

Name: Match the steps of transcription andtranslation to the location they
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: Match the steps of transcription andtranslation to the location they takeplace within a eukaryotic cell.[Choose]cytoplasmribosomenucleusMOlecuIeformation of the[Choose ]bond between Match the steps of transcription andtranslation to the location the

Biology Today and Tomorrow without Physiology (MindTap Course List)

5th Edition

ISBN:9781305117396

Author:Cecie Starr, Christine Evers, Lisa Starr

Publisher:Cecie Starr, Christine Evers, Lisa Starr

Chapter7: Gene Expression And Control

Section: Chapter Questions

Problem 15SQ

See similar textbooks

Similar questions

Given the following tRNA anticodon sequence, derive the mRNA and the DNA template strand. Also, write out the amino acid sequence of the protein encoded by this message. tRNA: UAC UCU CGA GGC mRNA: protein: How many hydrogen bonds would be present in the DNA segment?
Compare bacterial and eukaryotic mRNAs, and explain the functional significance of their structural differences.
Draw a typical eukaryotic gene and the pre-mRNA and mRNA derived from it. Assume that the gene contains three exons. Identify the following items and, for each item, give a brief description of its function: a. Transcription start site b. 3′ untranslated region c. Introns
Let's say there is an eukaryotic gene that has five exons and 4 introns. If the GU sequence at the 5' splice site of the third intron is deleted, describe how this is going to affect the expression of this gene. draw the mature mRNA too.
Describe the process of transcription of mrna in an eukaryotes cell.
The base sequence of the gene coding for a short polypeptide is 5’CTACGCTAGGCGATTGATCATC’3. What would be the base sequence of the mRNA transcribed from this gene? Highlight the start codon sequence State the amino acid sequence of the polypeptide translated from this mRNA Based on the information from part (a) and (b), describe the process used by eukaryotes to produce protein.
Using the transcription unit diagrammed below, in which exons are represented by blue boxes and introns are represented by the connecting lines. You discover a single base deletion in region E of this DNA sequence. Regarding transcription, this mutation will likely: 1.) Result in an alteration to the mRNA sequence. 2.)Have no effect on transcription or the mRNA sequence 3.)Prevent transcription at the TATAA box 4.) Result in an increase or decrease in the amount of mRNA transcribed
Arrange the processes involved from Transcription to Translation. 1 2 3 4 5 6 7 8 9 10 11 Translocation RNA polymerase binds in the promoter regions Elongation of RNA transcript Polypeptide cleavage DNA rejoins Partial unwinding of DNA Attachment of the mRNA to ribosome with AUG in the P site Binding of Rho factor Appearance of UAG codon Covalent bonding of AA to the tRNA Release of methionine and conversion to active protein
In eukaryotes there is not a consistent relationship between the length of the coding sequence of a gene and the length of the mature mRNA it encodes, even though one nucleotide in DNA = one nucleotide in pre-mRNA or primary transcript. Explain why this is so.
The following DNA nucleotides are found near the end of a bacterial transcription unit. 3′–AGCATACAGCAGACCGTTGGTCTGAAAAAAGCATACA–5′ Q. Draw a diagram of the RNA that will be transcribed from this DNA, including its nucleotide sequence and any secondary structures that form.
Determine the amino acid sequence for a polypeptide coded for by the following mRNA transcript (written 5'-> 3'): AUGCCUGACUUUAAGUAG
identify start/end site, which amino acid will be on the tRNA that is the first to bind to the A site of ribosome, anticodon on the tRNA in the P site of the ribosome when release factor bings to A site, and what amino acid sequence of the protein that will be formed from mRNA? Here is the mRNA sequence:5'GUUUCCCGUAUACAUGCGUGCCGGGGGCCCGUUACCAGGCCUCAUUAUUGGAUAACGGAAAAAAAAAAAAA3'