Most mutations are harmful or neutral, although in rare instances some can be beneficial wherethey might enhance the activity of the produced protein.Select one:TrueFalse

Name: Most mutations are harmful or neutral, although in rare instances som
Uploaded: 2024-03-20T06:42:55.000Z
Channel: Bartleby
Description: Most mutations are harmful or neutral, although in rare instances some can be beneficial wherethey might enhance the activity of the produced protein.Select one:TrueFalse

Answered: Most mutations are harmful or neutral,…

Science

Biology

Most mutations are harmful or neutral, although in rare instances some can be beneficial where hey might enhance the activity of the produced protein. select one: True False

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter11: Genome Alterations: Mutation And Epigenetics

Section: Chapter Questions

Problem 10QP: If the coding region of a gene (the exons) contains 2,100 base pairs of DNA, would a missense...

See similar textbooks

Similar questions

If the coding region of a gene (the exons) contains 2,100 base pairs of DNA, would a missense mutation cause a protein to be shorter, longer, or the same length as the normal 700 amino acid proteins? What would be the effect of a nonsense mutation? A sense mutation?
A protein was mutated at amino acid position 129. Which of the following mutations will least effect the protein's function? a.) R mutated to K b.) R mutated to L c.) R mutated to A d.) R mutated to D
Some mutations affect changes in protein structure and function that can result in disease whereas other mutations have no significant effects on protein structure and function. Please explain reasons for the above mentioned statement
Which of the following terms refer to the case when a mutation results in a significant decrease or a complete loss of the functional activity of a gene product? a. gain-of-function mutation b. loss-of-function mutation
Which do you think would be more likely to have an effect on protein function: a silent mutation or a missense mutation? Explain your answer
describe a mutation that does not alter the amino acid sequence of a protein
Suppose that a gene has a mutation that changes one nucleotide. Compared to the protein produced from the non-mutated gene, the protein produced from this mutated gene has one different amino acid. This newly altered protein provides enhanced resistance to tetracycline (an antibiotic). This type of mutation would be classified as a
An addition or deletion mutation that results in all of the amino acids after the mutation being wrong is called
under what condition will a single base change in a gene will not cause mutation in a protein
A mutation occurred that changes the sequence of DNA from: 5’ACGTCATGGATAGTGCGTAAACTA3’ to 5’ACGTCATGCGATAGTGCGTAAACTA3’ Describe the effect of this mutation on the protein, and give the name of the type of mutation.
What would happen if an allosteric enzyme had a T/R ratio of 0 as a consequence of a mutation?
Under what condition(s) will a single base change in a gene will not cause mutation in the protein