n I get help on this soon please?? I do not understand and I am stuck. This is a microbiology question. Explain in detail the beneficial effects of the following microorganisms on plants. In other words, how do these microorganisms help plants? - The bacterium Rhizobium - The fungi gro

n I get help on this soon please?? I do not understand and I am stuck. This is a microbiology question. Explain in detail the beneficial effects of the following microorganisms on plants. In other words, how do these microorganisms help plants? - The bacterium Rhizobium - The fungi gro

Biology 2e

2nd Edition

ISBN:9781947172517

Author:Matthew Douglas, Jung Choi, Mary Ann Clark

Publisher:Matthew Douglas, Jung Choi, Mary Ann Clark

Chapter31: Soil And Plant Nutrition

Section: Chapter Questions

Problem 12RQ: Which process produces an inorganic compound that plants can easily use? photosynthesis nitrogen...

See similar textbooks

Related questions

Q: n apurinic site. Assume a single depurination event occurs in the GC base pair of the sequence below…

A: Every cell has a class of enzymes called DNA glycosylases that recognise particularly common DNA…

Q: Explain how life is in the blood by using at least 5 biological key terms such as plasma,platelets,…

A: Biological Explanation:In the context of biology, life in the blood is intricately tied to its…

Q: for acrolein taint to occur glycerol is metabolized in the presents of _ _ _ _ _ _ _ _ _ _ _ _ _ _…

A: Acrolein taint refers to an undesirable off-flavor caused by the presence of acrolein in a food or…

Q: Discuss the impact parasites have on food webs and whether, or not, they should be included in such…

A: Parasites play an important role in food chains. They have the potential to significantly alter…

Q: What is the normal range for RBC, Hgb, HCT, WBC, and Platelet and their relevance to a patient with…

A: Blood is a thpe of fluid connective tissue made of different kinds of blood cells. These blood cells…

Q: Familial Down syndrome is similar to primary Down syndrome in that it is caused by trisomy 21.…

A: Two normal copies of 14, two normal copies of 21: A.Two normal copies of 21, one normal copy of 14:…

Q: In roses, purple flower color is determined by the dominant P allele, while pphomozygotes are white.…

A: The objective of the question is to determine the correct statements about the genetic traits of the…

Q: The immunogenicit

A: Immunogenicity is the ability of any immunogen/pathogen to provoke/ generate both cell mediated and…

Q: True or False: Naturally occurring methylxanthines could function as insecticides which protect…

A: True.Naturally occurring methylxanthines, such as caffeine and theobromine found in coffee and cacao…

Q: Why would the nucleotide bases be represented as puzzle pieces, as in the illustration below? What…

A: The nucleotide bases in DNA are the basic units of hereditary code and their interaction is basic to…

Q: If a population of white throated sparrows was found in a much warmer climate, where homozygous…

A: Supergenes play a critical part within the hereditary makeup and evolutionary adaptability of life…

Q: . Describe the general structure of all cell membranes. How does this membrane structure determine…

A: 1. General Structure of Cell Membranes and Selective Permeability: Cell membranes are composed of a…

Q: 3'- AATAAAAAAGGTCCCAAAAAATTAGGGGAGACGGTACATAAA GAGTAGAGTCATAAATTTTAGAGATGCGTA - 5'

A: Following the hints and considering the complementary strand is required:Complementary DNA strand:…

Q: Suppose part of the amino acid sequence of a protein is N... Gly-Ala - Pro-Arg-Lys ...C. Which of…

A: A frameshift mutation occurs when nucleotides are inserted or deleted from the DNA sequence, causing…

Q: What is the sister group to Innovatiocaris maotianshanensis? The phylogeny shows that some named…

A: A clade is defined as a group that contains all the descendents of a common ansector thus forming a…

Q: In the complete absence of light, a rod will become strongly depolarized and increase its…

A: The question is asking about the behavior of rod cells in the retina of the eye in the complete…

Q: Your animal cell culture laboratory suddenly suffered from a bacterial contamination. Several…

A: B. The media is probably contaminated with Mycoplasma, due to the lack of cell walls they are the…

Q: Draw FA beta-oxidation and FA synthesis pathways Mitochondrion Cytosol

A: Fatty acid oxidation is also called beta oxidation. In each pass through this sequence one acetyl…

Q: 1/Vo 1/[S] with I without I d. with I with 1/vo without I 1/[S] 1/vo without I 1/[S] 3. The above…

A: 1/C0 = Km/Vmax ( 1/S ) + 1 / VmaxThis equation is a transformed form of the Michelis Menten equation…

Q: Briefly describe the steps in catabolism of glucose; showing the location where each step happens in…

A: Briefly describe the steps in catabolism of glucose; showing the location where each step happens in…

Q: What are the advantages of the amniotic egg?

A: The amniotic egg is a major evolutionary advancement that has several advantages, particularly for…

Q: abel the following graph, which indicates the temperature versus the percent of DNA that is single…

A: The melting temperature of DNA refers to the temperature at which 50% of a given DNA sample has…

Q: Q6.7. How will the population of birds change over the first few years? The population will grow…

A: Imagine a small city with no birds of a particular species. A few birds arrive and discover a…

Q: Two cultures of a facultative anaerobe are grown in the same medium, but one culture is exposed to…

A: Facultative anaerobes can live with or without oxygen. They prefer to live in aerobic condition, but…

Q: Subject: Environmental Physiology For carnivores and insectivores, the water content of food is…

A: For plant feeders, the water content of food is generally very high. So, the correct answer is:(c)…

Q: Why does the right ventricle have a bicuspid valve? a. The low pressure generated by the right…

A: The question is asking why the right ventricle of the heart would have a bicuspid valve. The…

Q: Disruptive selection is the promotion of _____. the standard form of a trait…

A: Disruptive selection, also known as diversifying selection, is a type of natural selection that…

Q: Required information Skip to question The Gram Stain This animation learning module will review the…

A: Gram staining is a scientific method that differentiates bacteria according to the structure of…

Q: In the following Fz population, we have the following data for plant height (cm) of individual…

A: Step 1.1 : 1 Calculate mean for F2.Mean (F 2) = (Sum of all plant heights) / (Number of plants)= (3…

Q: James Smith is a nursing student in her last semester of nursing school. She is working with a…

A: The objective of the question is to determine whether James Smith, a nursing student, violated…

Q: Rose plants are octoploid (octo = 8). Gametes from a rose plant contain 40 chromosomes. Indicate…

A: The correct statements are:The number of chromatids in a rose plant cell at G2 of the cell cycle is…

Q: Regarding the short film, "Biology of Skin Color" (in 250 to 300 words) - What is the relationship…

A: The relationship between melanin, geography, folate, and vitamin D is a complex interplay of biology…

Q: Identify at least two resources for Strategic Planning in cancer research

A: The objective of the question is to identify resources that can be used for strategic planning in…

Q: Create a recipe for evolution. In your recipe, include the ingredients (all of the elements that…

A: The objective of this question is to understand the key components and processes that drive…

Q: i need actual data reported in any literature about timothy syndrome please

A: For actual data on Timothy syndrome, the key findings from the foundational literature and…

Q: A 27-year-old male presents to the doctor with complaints of "heartburn" and painful, sour-tasting…

A: The question is asking about the type of mucosa that is normally found in the distal esophagus. The…

Q: 80 Refer to figure 1A of the Science Article. The reduction in animal weight with exposure to higher…

A: The objective of the question is to interpret the data given in the figure 1A of the Science Article…

Q: Chronic obstructive pulmonary disease in detail what are types and classification

A: Chronic obstructive pulmonary disease (COPD) is a chronic lung disease that causes obstructed…

Q: Last word is anterior

A: One could make transgenic flies that contain a series of deletions spanning ALL SEGMENTS of the…

Q: Which of the below would best be described as a metapopulation? Killer whales are predicted to…

A: Populations of a species that are geographically distinct yet linked by sporadic migration or…

Q: Nissl bodies correspond to which of the following cytoplasmic organelles? A. Golgi apparatus B.…

A: The question is asking to identify the cytoplasmic organelle that corresponds to Nissl bodies.

Q: 3. At what age or time in life does an individual acquire the antibodies against ABO antigensother…

A: 3. Individuals typically acquire antibodies against ABO antigens other than their own during the…

Q: Write a conclusion about "lubricating agents used in pharmaceutical industries"? Please answer at…

A: Lubricants are the substances which are used to reduce the friction between two surfaces which are…

Q: How might virus infection lead to increase energy production in the cell? Group of answer choices…

A: The objective of the question is to understand how a virus infection can lead to increased energy…

Q: What is the validity of concern for potential marine extinction? Defend these concerns or lack…

A: Concern for potential marine extinction is undeniably valid given the multitude of threats…

Q: Subject: Environmental Physiology Why is intense physical activity challenging for poikilotherms?

A: The question is asking about the challenges faced by poikilotherms, also known as ectotherms, during…

Q: Question 4

A: The question is asking about the famous experiment conducted by Oswald Avery and his colleagues in…

Q: Q6.5. What does the carrying capacity for moose on the island primarily depend on? The number of…

A: Explanation of carrying capacity:Carrying capacity refers to the maximum population size of a…

Q: Observed numbers of mosquitoes by kdr genotype +/+ +/r r/r A. gambiae Pre-2006 3 5 2 2006 8 8 7…

A: “Since you have posted a question with multiple sub-parts, we will provide the solution only to the…

Q: The concept of eco immunology states that biotic and abiotic features influence the evolution and…

A: The human gut harbors a complex ecosystem of microorganisms, collectively known as the gut…

Concept explainers

Plant sensory system

The plant sensory system is a sophisticated system that responds to environmental stimuli such as light,temperature, gravity, and touch. Research predicts that plant hormones and signaling mechanisms areresponsible for this regulation system in plants.

Question

Hi can I get help on this soon please?? I do not understand and I am stuck. This is a microbiology question. Explain in detail the beneficial effects of the following microorganisms on plants. In other words, how do these microorganisms help plants? - The bacterium Rhizobium - The fungi group called mycorrhizae

Definition Definition Diverse group of organisms that primarily obtain nutrients through absorption. They range from single-celled yeasts to complex multi-cellular structures such as mushrooms. Fungi play important roles in ecosystems as decomposers, plant symbionts, and even pathogens. They also have practical uses in medicine, food production, and industry.

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1: Introduction

VIEW

Step 2: Explanation

VIEW

Solution

VIEW

Step by step

Solved in 3 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

Bio medicine made from? Where does the plant grow of bio medicine? The history of bio medicine? Manufacturing process of bio medicine? The environmental and social and also economic impacts of producing this bio Medicine describe those question please. It'll great help if you help me.
Please help me with questions 1 through 3. I greatly appreciate it and thank you very much! 1. Write down 4 keywords you will use in your search to find articles on your experimental organism, Brassica rapa. 2. Give an example of an chemical variable and describe how it may affect plant growth. 3.Give an example of a biological variable and describe how it may affect plant growth.
Instructions: MULTIPLE CHOICE Only choose the correct answer, and no need for an explanation. 1. Which of the following is a characteristic of the endotrophic mycorrhizae root symbiont? A. Mycorrhizae invades the cytoplasm of root cortical cells. B. It forms an encrusting layer of hyphae called the mantle. C. Occur in the roots of pines and oaks trees. D. Mycorrhizae penetrates the root cortex but fungal hyphae do not enter the cells. 2. The endodermis surrounds the stele or vascular cylinder of the stem and leaves of vascular plants except which of the following group? A. gymnosperms B. pteridophytes C. angiosperms D. bryophytes
Help me solve the stomatal density. For a 10x ocular, the diameter of field of view for the LPO (10x) is 1.78 mm while HPO (40x) is 0.45 mm.
Why does pouring salt on a weed act as a weed killer? this should be an original thought, not Google’s. 3-4 sentences
Help me answer the following problem correctly and completely. it will be a big help, Thank you! * Identify the things that wouldn’t have been there without soil. Discuss why soil is important for their existence. Would there be alternatives to the soil to create these things? What are they?
What is the function of C4 plants and CAM plants in photosynthesis? Make the explanation as short (not super short like it's straight forward) this is for our reporting, i'm assign on the function. SUBJECT : CAM AND C4 PHOTOSYNTHESIS 1. Definition 2. Difference 3. Function (this is my part) 4. Inputs and outputs 5. Duration and occurrences Thank you and stay safe!!
Help me solve the stomatal density of IXORA PLANTFor a 10x ocular, the diameter of field of view for the LPO (10x) is 1.78 mm while HPO (40x) is 0.45 mm.
I need it ASAP please. Using the test results above, will it support the study entitled: The antifungal components of Plant X. State whether yes or no. Justify your answer
I need help finding and labeling the epidermis, phloem, xylem (vascular bundle) and pith (parenchyma) of the sunflower cell.
I need help finding and labeling epidermis, phloem, xylem (vascular bundle) and pith (parenchyma) of the tulip cell.
I need help finding and labeling epidermis, phloem, xylem (vascular bundle) and pith (parenchyma) of the tulip cell (please take a photo of showing were the label part are).