Nascent form of the mRNA A. undergoes splicing only after capping B. is also called hnRNA C. is polyadenylated after splicing D. participates in the spliceosome assembly for splicing E. joins snRNPs to form the spliceosome assembly
Q: (a) dues in the polypeptide. Place the label or an arrow on the Ca atom of both residues. Label the ...
A: Proteins are composed of amino acids, which are bound together by peptide linkage. Amino acids conta...
Q: 14. Naturally occurring fats are A. L types B. D types C. an equi-molar mixture of L and D types D. ...
A: Fat is often used in nutrition, biology, and chemistry to refer to any ester of fatty acids or a com...
Q: Sort the electron acceptors that are able to diffuse inside the mitochondrial matrix from those that...
A: Protein complexes are present in the inner membrane of mitochondria forming an electron transport ch...
Q: Giveee a sufficient biosynthesis for this compound starting from acetyl CoA, S-alanine, S- adenosyl ...
A: Here compound 14 is synthesized from L-Phenylalanine, SAM, L-alanine, and Acetyl-CoA in multistep p...
Q: 1. The overall charge of this protein at pH 7 is Drop-down answer choices are [positive, negative, o...
A: Proteins are composed of amino acids, which are bound together by peptide linkage. Amino acids conta...
Q: 1) Below you are given the structures of the disaccharides lactose and trehalose. но OH OH OH но но ...
A: Lets first assume that all the carbohydrates given here are D isomers , cause that the general case ...
Q: What is the biological importance of carbon, nitrogrn and phosphorus?
A: Biomolecules are organic substances, which are majorly composed of carbon. Nitrogen and phosphorous ...
Q: *Which of the following statements about allosteric enzymes is NOT true? Question 10 options: - They...
A: Enzymes are biocatalysts that increase the rate of a reaction by a factor of several. Living cells a...
Q: of sodium and potassium (that leads to hyponatremia and hypokalemia), hypocalcemia and ostcoporosis,...
A: In butler Albright syndrome Patients suffering from renal tubular acidosis, nephrocalcinosis, and re...
Q: What are the different blood groups?
A: Based on absence or presence of antibodies and inherited antigen on the Red Blood Cell (RBC) differe...
Q: (a) A solution containing these five proteins was adjusted to pH 7.0 and then applied to a SIZE-EXCL...
A: Chromatography is a method of separation of specific compounds from the mixture of compounds. This c...
Q: Urease enzyme hydrolysed urea at [S]= 0.03 mmol/L with a Km value of around 0.06 mmol/L. The initial...
A: Vmax is the reaction's maximum speed at which all of the enzymes become saturated with the substrate...
Q: Which of the polysaccharides WILL DECREASE GELLING if acid is added to the sample? pectins ...
A: Gels are solid, jelly-like structures made of colloid polysaccharides, proteins, and polymers produc...
Q: ACTIVITY 7.2.2 Show and explain how exactly the condensation reaction to form a nucleotide happens. ...
A: Nucleotides are the phosphoric acid esters of nucleosides with the phosphate group. Nucleotides are ...
Q: A bowl of pasta contains 45 g of carbohydrates. How much energy can possibly be released after its c...
A: Total Carbohydrate in pasta = 45g Molecular weight of Glucose = 180 g/mol
Q: You'lre hungoy, body Cmuttiple g the following e optim posei ble) which Occur in Our toonelete (A) À...
A: Hungryness is a feeling that stimulates food intake. There are number of pathways that stimulate goo...
Q: You have a mixture of positive, negative and neutral proteins. In order to obtain a pure positively ...
A: Proteins are composed of amino acids, which are bound together by peptide linkage. Amino acids conta...
Q: An a strain of yeast that cannot switch mating type isisolated. What mutations might it carry that w...
A: Yeast is a kind of organism that lives Saccharomyces cerevisiae is a single-celled eukaryote that ma...
Q: What ligand on transferrin is responsible for the red color of the iron loaded transferrin. please e...
A: Transferrin is a 76 kDa glycoprotein which transport iron through blood plasma in Fe3+ state. It bin...
Q: 2. You have made a mutation in myoglobin that increased the Pso for O2 by a factor of 2. Sketch out ...
A: Myoglobin is a non-allosteric enzyme found in muscle cells. The main function of myoglobin is to sto...
Q: An enzyme catalyzes a reaction with a Km of 7.50 mM and a Vmax of 2.90 mM · s-!. Calculate the react...
A: Enzymes are highly specialized proteins that have extraordinary catalytic power, greater than that o...
Q: Use the image below to determine what stage of the dog's life cycle is spent in the haploid state? (...
A: Haploid stage is the condition at which cell contains only one set of chromosomes in its nucleus Dip...
Q: D-Erythrulose in ring structure:
A: Introduction: Carbohydrates are also known as saccharides consist of carbon, hydrogen, and oxygen. ...
Q: Q24. Choose the best answer for the following questions.
A: Amino acids are building blocks of proteins and also important as a precursor for the biosynthesis o...
Q: Write the structure formula, three-letter and one-letter abbreviation for each essential amino acid ...
A: There are twenty naturally occurring amino acids that form proteins in biological systems.
Q: What is the AG for the following reactions: ATP + H20 → ADP + P. AG= ADP + P → ATP + H20 AG =
A: Hi! Thank you for the questions. As you have posted multiple questions, I will be answering the firs...
Q: a reasonable biosynthesis for Compound 14 starting from Propose alanine, S-phenylalanine and ATP.
A: Given compound in a figure is Aspartame. It is an artificial sweetener and is made by dipeptide of a...
Q: 5' 3' For numbers 6 to 10, refer to the image above and answer the questions. 6. Which among the two...
A: Hi! Thanks for your question. As you have posted multiple questions and have not mentioned which one...
Q: When answering the questions below, please use the ONE-LETTER CODE for the amino acid, with NO space...
A: The determination of primary structure of a protein is crucial since the sequence of the protein det...
Q: Show the separation pattern of the following DNA molecules on 1 % agarose gel. Justify your results....
A: Introduction: Agarose gel electrophoresis is a molecular biology technique to analyze and separate ...
Q: Compare and contrast antibiotic and antiviral treatments. Analyze how different antiviral therapies ...
A: Antibiotics are the group of antimicrobial substances which are used to inhibit or to destroy any mi...
Q: Which of the following statements is FALSE? Select one: a. Secondary structure of a protein determin...
A: Amino acids are monomers of protein they are linked with each other by forming peptide b...
Q: Are there any research involving white vinegar that it is effective as an ingredient in making insec...
A: Vinegar is an aqueous solution of acetic acid and trace compounds, which may or may not contain flav...
Q: Vitamin A in vision Vitamin C in collagen formation Vitamin K in blood clothing
A: Vitamins are the organic compounds that requires in small quantities. Vitamins have wide variety of ...
Q: Which of the following contain statements that are both correct? Aspartame triggers the cellul...
A: Aspartame is an artificial sweetener. It first binds and activate a GPCR. The G-alpha bound to GTP ,...
Q: Using a semi-permeable membrane, dialysis allows the removal of salt ions prior to chromatography. T...
A: Dialysis is a separation process that uses selective and passive diffusion via a semi-permeable memb...
Q: Draw the structure of following peptide: Glu-Asp-His-Cys-Gly-Arg (B) At pH= 10.7 (A) At pH= 2.1
A: Peptides or proteins are composed of twenty standard amino acids attached together via peptide bonds...
Q: In Figure 12-26, provide a biochemical mechanism forwhy HP-1 can bind to the DNA only on the left si...
A: The family of heterochromatin protein 1 (HP-1) consists of highly conserved proteins which perform a...
Q: Which statement(s) correctly describe(s) protein structures? A. All hydrophobic residues are buried ...
A: Proteins are made up of amino acids, which are the building blocks. Around 20 different amino acids ...
Q: Explain the enzymes.
A: Enzyme, a molecule that works as a catalyst in living organisms, regulating the pace at which chemic...
Q: ideroblastic anemia is observed in the deficiency of which of the following? * (Please choose one co...
A: Vitamins are the organic compounds required for the proper functioning of the body. The vitamins are...
Q: H-bonds a
A: here they are talking about the secondary structure of protein. Secondary structure, the next level ...
Q: The first 15 bases of the original informational strand of DNA (which continues after what is shown)...
A: Mutation is the change in DNA sequence caused due to various factors. Mutations take place during DN...
Q: What are the characteristics of an ideal antimicrobial agent?
A: Microorganisms have a very large world. Some are beneficial to live creatures, while others are harm...
Q: 10. The degree of unsaturation of lipid can be measured as A. saponification number B. iodine number...
A: Saturated fats are the fatty acids in which the hydrocarbon chain with a carboxyl group contains car...
Q: Given a Glucuromic acid omd glutathione for A) are impartantto PhaseI xemabistic melabolism B) srond...
A: Glucuronic acid is a sugar carboxylic acid which is generated by the oxidation of the C-6 carbon of...
Q: What is/are the end product(s) of protein digestion?
A: Disclaimer: “Since you have asked multiple question, we will solve the first question for you. If yo...
Q: 50 Which best describes the role of FADH2 in aerobic metabolism? O FADH2 is a proton shuttle and tra...
A: Metabolism includes biosynthesis/ reduction (an anabolic process) and oxidation (catabolic p...
Q: 1. Which of the following molecule can act as molecular chaperons for assisting the folding of prote...
A: A broad set of unrelated protein families whose function is to stabilise unfolded proteins, unfold t...
Nascent form of the mRNA
A. undergoes splicing only after capping
B. is also called hnRNA
C. is polyadenylated after splicing
D. participates in the spliceosome assembly for splicing
E. joins snRNPs to form the spliceosome assembly
-
B, C, D, E only
-
A, B, C only
-
A, B, C, D, E
-
A, B, D, E only
Step by step
Solved in 2 steps
- Portions of eukaryotic mRNA sequence that are removed during RNA processing are . a. exons b. caps c. poly-A tails d. intronsA geneticist induces a mutation in eukaryote cells. The mutation results in an inability to form the poly(A) tail during processing of pre-mRNA. What does this mean for the mature mRNA and what will be the effect on these cells? Possible Answers: A. The mRNA will be spliced, but will not have a 5' cap. B. The mRNA will likely be degraded. C. The mRNA will not be cleaved. D. The mRNA will have too many Gs and Cs.Which of the following is a processing step that must happen to mRNA before it is translated? Choose all that apply. A) Addition of a poly-A tail B) Splicing out introns C) annealing into a double-stranded helix D) cleavage E) Addition of a 7-methlguanosine cap
- The portion of the mRNA that is removed during splicing is (a) an inverted repeat (b) the promoter (c) the poly A tail (d) the intron (e) the exona) introns removed b) exons removed c) 5' cap added d) 3' cap added e) poly G tail added to 5' end f) poly A tail added to 3' end g) a cap binding protein added to the 5' end h) poly A binding proteins added i) of these answers, b, c, and f only j) of these answers, a, c, and f only . k) of these answers a, c, f, g, and h only Pre-mRNA must undergo which of the following modifications before leaving the nucleus?Why is the post-transcriptional polyA tail an important addition to a mRNA molecule? a.poly A tail is part of the protein translated from the mRNA b.poly A tail facilitates the binding of ribosomes c.3' tail signals the end of transcription by the RNA polymerase d.the tail adds stability to the transcript, controlling the time of degradation e.poly A tail facilitates the splicing of introns
- Which of the following statements are true about eukaryotic mRNA?a. The sigma factor is essential for the correct initiationof transcription.b. Processing of the nascent mRNA may begin beforeits transcription is complete.c. Processing takes place in the cytoplasm.d. Termination is accomplished by the use of a hairpinloop or the use of the rho factor.e. Many RNAs can be transcribed simultaneously fromone DNA templateA mutation in a/ an _____ sequence of a gene would be associated with loss of detectable mRNA from that unit. A) promoter B) exon C) intron D) splice site E) terminatorintrons: A)are parts of the new strand replaced with DNA nucleotides during replication B)Are joined together with other introns to make the mature mRNA C)are found in prokaryotic cells D)are binding sites for repressors; therefore introns are involved in controlling gene expression E)do not contain codons or information about proteins; they are removed from the mRNA during splicing/editing of mRNA
- A single template strand of a DNA molecule is represented by 3’atgtaccatgcgcaaatttaaaggccc5’. a) Using the same strand above as a template, write the pre-mRNA transcript. b) List the molecules that must be present for DNA to be transcribed. Briefly describe their function. c) What are three modifications that happen to pre-mRNA before it becomes mature mRNAThe splicing process a. occurs in prokaryotes. b. joins introns together. c. can produce multiple mRNAs from the same transcript. d. only joins exons for each gene in one way.Which of the following statements about RNA processing in eukaryotes is INCORRECT? A. The excision of introns from pre-mRNA is the only modification required to produce a mature mRNA. B. A protein/RNA complex is used to remove introns from the pre-mRNA. C. A poly A tail is added on to the 3′ end of the mRNA. D. A 7-methylguanosine cap is added on to the 5′end of the mRNA. E. Modification occurs in the nucleus.
