The first 15 bases of the original informational strand of DNA (which continues after what is shown) are 5-ATGAAACCCGGGTTT(...)-3'. Which of the following mutations to this original strand would lead to a frame shift? (Again, only the first 15 bases of the DNA strand are shown, even though they continue on.) Mutation #1: 5-ATGAAAGCCCGGGTT(...)-3' Mutation #2: 5-ATGAACCCCGGGTTT(...)-3' Mutation #3: 5-ATGAACCCGGGTTTA(...)-3'

The first 15 bases of the original informational strand of DNA (which continues after what is shown) are 5-ATGAAACCCGGGTTT(...)-3'. Which of the following mutations to this original strand would lead to a frame shift? (Again, only the first 15 bases of the DNA strand are shown, even though they continue on.) Mutation #1: 5-ATGAAAGCCCGGGTT(...)-3' Mutation #2: 5-ATGAACCCCGGGTTT(...)-3' Mutation #3: 5-ATGAACCCGGGTTTA(...)-3'

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter11: Genome Alterations: Mutation And Epigenetics

Section: Chapter Questions

Problem 10QP: If the coding region of a gene (the exons) contains 2,100 base pairs of DNA, would a missense...

See similar textbooks

Similar questions

If the DNA sequence A-T-T-G-G-C-C-T-A on an informational strand mutated and became A-C-T-G-G-C-C-T-A, what effect would the mutation have on the sequence of the protein produced?
1. a) If one DNA segment has the following base composition, 5'-CAGTTAGTCA-3', which of the following sequences is complementary? op 1: 3'-CAGTTAGTCA-5' op 2: 3'-TGACTAACTG-5' op 3: 5'-TGACTAACTG-3' op 4: 3'-TGACTAACTG-5' b) What is the nucleotide sequence of the DNA strand that is complementary to 5'-ATCGCAACTGTCACTA-3' op 1: 5'-TAGCGTTGACAGTGATA-3' op 2: 5'-TAGTGACAGTTGCGAT-3' op 3: 5'-ATCACTGTCAACGCTA-3' op 4: 5'-UAGUGACAGUUGCGAU-3'
The DNA STRAND IS 3’ TAC-AGC-ACT-CAG-TCA 5’, and Non-template strand = 5' - ATGTCGTGAGTCAGT - 3' . If on the non-coding strand of DNA there is suddenly one T base that sneaks into the 4th sequence (from the left), or causes a mutation, then how will the RNA be formed and the chain arrangement of the amino acids produced by this mutation?
Below is a sample of a segment of DNA…(copy from left to right) 3’ TACAATGGGCGACGCGCTTCGTTTCAGATT 5’ 5’ ATGTTACCCGCTGCGCGAAGCAAAGTCTAA 3’ 1.Assume the 6th amino acid is changed from T to G on the DNA template strand. What type of mutation is this? What effect would this have on the protein? Look up an example for this type of mutation. 2, Assume the 5th and 6th amino acids are removed from the DNA template strand. What type of mutation is this? How would this affect the protein? Look up an example of this type of mutation. 3.Which mutation changes the protein more...a point mutation or a frameshift mutation. Explain your reasoning. 4.What would be the problem if ATT was inserted into the DNA template strand after the second codon? (Be sure to consult the coding chart for amino acids). 5. What if the second amino acid was repeated over 5Ox. What amino acid is repeated? What type of mutation is this? If this is on chromosome 4, what genetic disorder is this?…
What is the nucleotide sequence of the DNA strand that is complementary to 5'-GGCGCAACTGTCACAA-3'?
Why do higher salt concentrations stabilize the DNA double helix? Or What aspect of the structure of double-stranded DNA destabilizes the helix in the absence of salt?
Look at the double-stranded segment of DNA shown below. Imagine that the two strands have already been denatured, and the temperature has been decreased to an appropriate annealing temperature. Show where the two primers would anneal to the strands, then indicate the direction of extension on each new strand with an arrow. 5’--T C A G G A C G T A A G C T T G C A T A T C T C G A T G C T A A A T C A T—3’ 3’--A G T C C T G C A T T C G A A C G T A T A G A G C T A C G A T T T A G T A—5’ Primer #1: 3’ A C G A T T T 5’ Primer #2: 5’ G G A C G T A 3’
What part(s) of a nucleotide (namely, phosphate, sugar, and/or base) is/are found in the major and minor grooves of double-stranded DNA, and what part(s) is/are found in the DNA backbone? If a DNA-binding protein does not recognize a specific nucleotide sequence, do you expect that it binds tothe major groove, the minor groove, or the DNA backbone? Explain.
The double helical structure of DNA is intrinsically unstable and easily dissociates to form two separate strands. Why? How does this affect the two key biological functions of chromosomal DNA? What would happen if the DNA helices were too stable?
The DNA STRAND IS 3’ TAC-AGC-ACT-CAG-TCA 5’ and Non-template strand = 5' - ATG-TCG-TGA-GTC-AGT - 3' . If on the non-coding strand of DNA there is suddenly one T base that sneaks into the 4th sequence (from the left), or causes a mutation, then how will the RNA be formed and the chain arrangement of the amino acids produced by this mutation? 4th sequence (from the left) should be = TCG right?
If the coding region of a gene (the exons) contains 2,100 base pairs of DNA, would a missense mutation cause a protein to be shorter, longer, or the same length as the normal 700 amino acid proteins? What would be the effect of a nonsense mutation? A sense mutation?
In some organisms, UV-induced thymine dimers can be repaired by photoreactivation, in which energy from visible light is used to split the bonds forming the cyclobutane ring ? true or false Non-homologous end joining occurs when enzymes cut out a few nucleotides around a double strand DNA break, and then fuse the ends back together (right) true or false?