Q: Which of the following is NOT true regarding E. coli replication on the lagging strand? initially…
A: In molecular biology, DNA replication is the process of making two identical DNA molecules from one…
Q: 1f) If you took more of the same randomly generated 1000 bp fragments of binturong DNA (the same…
A: Deoxyribonucleic acid is a particle made out of two polynucleotide chains that loop around one…
Q: The beta subunits of E.coli DNA polymerase III are responsible for its _______. A. ribosome…
A: In prokaryotes, the DNA replication is carried out with the help of various enzymes, like, DNA…
Q: A linear piece of DNA that is 30 kb long is first cut with BamHI, then with HpaII, and, finally,…
A: The restriction enzyme is a protein and it recognizes a specific sequence of short nucleotides and…
Q: Describe the processes involved in denaturing and renaturing of DNA, and explain what is useful…
A: DNA stands for deoxyribonucleic acid. It is the genetic material of the organisms that transfer from…
Q: what is the difference between DNA microarray and Fluorescence in situ technique? or is the…
A: Difference between FISH and Microarray Technique Fluorescence In Situ Hybridization It is possible…
Q: 2. Dr. Kim at Research Center performed shotgun Sanger sequencing on an unknown DNA sample, and…
A: In conventional sequencing method, in a reaction mixture, single-stranded molecules of the DNA,…
Q: What is meant by “proofreading” with respect to DNA polymerase?
A: DNA polymerase belongs to the member of the family of enzymes that play the role in catalyzing the…
Q: Which primer would be appropriate to amplify the top strand of the DNA molecule shown? 5'…
A: Polymerase chain reaction is a method widely being used to make multiple copies of the same DNA…
Q: Is the template strand read in the 5′ to 3′ or the 3′ to 5′ direction?
A: DNA (deoxyribonucleic acid) replication is a semiconservative process where each strand in the…
Q: For what purposes is DNA extraction done? (give at least 3 purposes for which you may need to…
A: A technique that is used to isolate DNA from a biological sample is referred to as DNA extraction.…
Q: How does proofreading improve replication fidelity?
A: Proofreading is a mechanism by which DNA polymerase improve the fidelity of DNA replication.…
Q: Describe the Meselon -Stahl experiment Include how they distinguished new from old DNA strands,…
A: Meselson and Stahl Experiment In 1958, Matthew Meselson and Franklin Stahl performed an experiment…
Q: List the steps in the polymerase chain reaction; discuss one disadvantage to this technique
A: Introduction Almost all the molecular biology techniques revolve around DNA/RNA/Proteins. DNA is one…
Q: During proofreading, which of the following enzymes reads the DNA? a. primase b. topoisomerase c.…
A: BASIC INFORMATION DNA it stands for deoxyribo nucleic acid. it is the genetic material of all…
Q: In a standard procedire, when writing and reading base sequences for nucleic acids (both DNA and…
A:
Q: What are the disadvantages of doing DNA sequencing?
A: DNA sequencing is a process of identifying the order of nucleic acid bases i.e. adenine, guanine,…
Q: Would you choose an exonuclease while producing a recombinant DNA molecule?
A: Exonuclease eliminates nucleotides from the ends of the DNA and thus it can't help in secluding…
Q: 5. Show the separation pattern of the following DNA molecules on an agarose gel electrophoresis. 5…
A: Forms of DNA gives different band pattern.
Q: Which vectors can be used to clone a continuous fragment of DNA with the following lengths? a. 4 kb…
A: According to the question, we have to mention the name of the vectors that can be used to clone a…
Q: 1)explain why it is far less important for RNA Polymerase to have proofreading activity than it is…
A: Fidelity of replication is the most important for the very existence of an organism. Besides its…
Q: How do the enzymes involved in the mismatch repair process determine which of the two bases in the…
A: DNA polymerases are the enzymes that build DNA in cells. During DNA replication (copying), most DNA…
Q: If you repeat the okazaki experiment WITHOUT denaturing DNA, what would be the expected outcome? O…
A: The Okazaki experiment explained that the process of DNA replication is discontinuous and also…
Q: Does proofreading always take place by the same process in replication?
A: REPAIR PATHWAYS:- Both in Prokaryotes and Eukaryotes, there is a repair enzyme system to deal with…
Q: What is meant by semi conservative replication? How did Meselson and Stahl prove it experimentally?
A: DNA is the information hub of the cell that contains instructions for the synthesis of proteins. The…
Q: Dideoxysequencing relies on which one of the following choices: A):Random stopping of one of many…
A: Introduction :- Dideoxysequencing is used in sanger sequencing. Sanger sequencing is a DNA…
Q: he 3'____> 5' exonuclease activity of E. coli DNA polymerase III aacounts for the ____________ of…
A: This is the enzyme complex that is primarily involved in DNA replication with the aid of four other…
Q: 4a. Was this micrograph taken of a sample prepared from human cells or prokaryotic cells? How do you…
A: Since you have posted a question with multiple subparts, we will solve the first three subparts for…
Q: Thank you!!!
A: Setting up controls is an important step in any biological experiment. It ensures that the results…
Q: What advantages do cDNA libraries provide over genomic DNA libraries? Describe cloning applications…
A: DNA is the genetic material in most living organisms. It is the information hub of the cell that…
Q: what are some Limitations/sources of error with suitable rationalization that may occur during the…
A: PCR is in vitro method for amplifying defined target DNA sequences present within the source of DNA.…
Q: Covalent modification of the E. coli origin of replication (oriC) is required for initiation to…
A: Escherichia coli is a prokaryotic organism that contains DNA, RNA, and protein in the cytoplasm. E.…
Q: Which of the following reactions is required for proofreading during DNA replication by DNA…
A: DNA polymerase III is the primary enzyme complex which is involved in prokaryotic DNA replication.…
Q: 1. Upon the banana DNA extraction, what do you see in the top portion of the liquid when you look at…
A: DNA (Deoxyribonucleic Acid) is the genetic material of all living organisms whether plant, animal,…
Q: Draw a Concept Map of the Central Dogma in order to summarize and connect the concepts. Write…
A: Central Dogma is a flow of information that is present in the form of nucleotide sequence on the DNA…
Q: Explain and list down the protocols in doing or preparation of materials for polymerase chain…
A: Polymerase chain reaction (PCR) It is an in vitro technique that takes a specific sequence of DNA…
Q: 1. The following gel was produced in manual DNA sequencing. What would the unknown DNA template be…
A: The method of determining the nucleic acid sequence – the order of nucleotides in DNA – is known as…
Q: If you took more of the same randomly generated 1000 bp fragments of binturong DNA (the same sample…
A: DNA is composed of two polynucleotide chains that coil around each other to form a double helix. It…
Q: After ONE round of DNA replication in Meselson and Stahl's classic experiment, the semiconservative…
A: DNA replication is the natural cycle of creating two indistinguishable reproductions of DNA from one…
Q: Hi, I would like to know which program is used for the graphical presentation of the results of a…
A: A genome wide linkage association study (GWAS) is an approach used in genetic research to associate…
Q: hat is the difference between prokaryotic and eukaryotic DNA polymerase.?
A: A DNA polymerase is an enzyme that helps in the synthesis of DNA molecules by using nitrogenous…
Q: What is the results of extracting the DNA of a strawberry?
A: Ripe strawberries are an excellent source for extracting DNA because they are easy to pulverize and…
Q: Discuss the importance of adding radioactively labeled molecules during 16S ribosomal RNA sequencing…
A: The bacterial isolates can be identified accurately by the 16S ribosomal ribonucleic acid (rRNA). It…
Q: 24. Which of the following is a mismatch? Polymerase – Taq polymerase Template - double stranded DNA…
A: Since we have been instructed to answer only one question in a post, post other questions…
Q: Describe the proofreading activity of DNA polymerase.
A: Although DNA polymerase is a very effective enzyme, it can potentially introduce an erroneous…
Q: What is the velocity of movement (in micrometers per second) of DNA polymerase III holoenzyme…
A: Axial distance between nucleotides in B- DNA is 3.4 R catalytic rate of DNA polymerase 111 is 1000…
Q: SSBs are: single-stranded DNA binding proteins that prevent re-annealing supercoil stabilizing…
A: DNA replication is the biological process that occurs in every organism, through which they copy…
Q: Describe at least three proof-reading mechanisms to achieve High Fidelity of DNA replication.
A: DNA proof-reading is a process of error correction in DNA. It is also called as the DNA repair…
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- Reiji and Tuneko Okazaki conducted a now classic experiment in1968 in which they discovered a population of short fragmentssynthesized during DNA replication. They introduced a shortpulse of 3H-thymidine into a culture of E. coli and extracted DNAfrom the cells at various intervals. In analyzing the DNA aftercentrifugation in denaturing gradients, they noticed that as theinterval between the time of 3H-thymidine introduction and thetime of centrifugation increased, the proportion of short strandsdecreased and more labeled DNA was found in larger strands.What would account for this observation?Human Genome Replication Rate Assume DNA replication proceeds at a rate of 100 base pairs per second in human cells and origins of replication occur every 300 kbp. Assume also that human DNA polymerases are highly processive and only two molecules of DNA polymerase arc needed per replication fork. How long would it take to replicate the entire diploid human genome? How many molecules of DNA polymerase does each cell need to carry out this task?Approximately how many high-energy bonds does DNA polymerase use to replicate a bacterial chromosome (ignoring helicase and other enzymes associated with the replication fork)? compared with its own dry weight of 10–12 g, how much glucose does a single bacterium need to provide enough energy to copy its DNA once?
- This is a three part question: Figure B in Box 4.1 illustrates the results of the Meselson-Stahl experiment after a single cycle of replication in 14N. (a) Explain the results they observed after two rounds of replication in 14N medium. (b) Draw out the expected results if a third round of replication were allowed in 14N medium. (c) Two other models for template-directed replication were considered as alternatives to semi-conservative replication. One of these was conservative replication, in which the parental strands were unpaired, replicated, then reannealed such that the parental strands stayed together and the newly synthesized strands were together. The second model was dispersive replication, in which one strand was used as the template for polymerization, then the polymerase switched to using the other strand as the template, and subsequently switched back and forth between the two strands until bother were fully replicated. Each of these models is ruled out by one of your…Let’s assume the linker region of DNA averages 54 bp in length. How many molecules of H2A would you expect to find in a DNA sample that is 46,000 bp in length?In bacterial cells, nucleotide excision repair involves which of the following proteins? DNA glycosylase AP endonuclease photolyase AlkB UvrABC proteins If Meselson and Stahl had results from density gradient analysis of bacterial DNA that indicated only two bands, one of the original density and one that was the same as unlabeled DNA, and no intermediate density band, this would indicate that DNA replication is: constructive semiconservative conservative consecutive cannot determine from the information given 6.In E. coli, which DNA polymerase is primarily responsible for filling in the gaps in the DNA generated during nucleotide excision repair? DNA polymerase I DNA polymerase II DNA polymerase IV DNA polymerase V none of the above
- a) "Out of three E.coli DNA polymerases, DNA polymerases 3 has a high processivity and rate of polymerization and therefore better suited for replication of the genome" What is meant by processivity? how does the DNA polymerase 3 maintain high processivity? b) What is a replication fork ?. Give the protein/enzymes of a replication fork and describe their function?Even in automated sequencing, where you can include all 4 ddNTPs in one reaction, you need to include "normal" dNTPs as well as the ddNTPs - why are these necessary? Why can't you just put in the ddNTPs, since you've got all four of them available to the DNA polymerase?Can you please help with 1f please picture with 1 graph is for question 1a) picture with 4 graphs is for question 1b) 1a) E. coli DNA and binturong DNA are both 50% G-C. If you randomly shear E. coli DNA into 1000 bp fragments and put it through density gradient equilibrium centrifugation, you will find that all the DNA bands at the same place in the gradient, and if you graph the distribution of DNA fragments in the gradient you will get a single peak (see below). If you perform the same experiment with binturong DNA, you will find that a small fraction of the DNA fragments band separately in the gradient (at a different density) and give rise to a small "satellite" peak on a graph of the distribution of DNA fragments in the gradient (see below). Why do these two DNA samples give different results, when they're both 50% G-C? 1b) If you denatured the random 1000 bp fragments of binturong DNA that you produced in question 1a by heating them to 95ºC, and then cooled them down to 60ºC and…
- What observation in the Meslson and Stahl experiment to decipher the DNA replication model distinguishes the semi-conservative from the dispersive mode of replication? Explain.A scientist successfully analyzed a new micro-organism. Because this micro-organism contains double-stranded DNA as genetic material, Meselson-Stahl techniques was employed. The following shows the results of the experiment where L – light chain (14N) and H – heavy chain (15N).What is the mechanism of replication in this organism in the picture? Explain how you got the answer. The following piece of DNA is sequenced using the dideoxy method: 3’-AAGCGGCTAATCC-5’. Accidentally, you forget to include dATP in the four reactions that contain a ddNTP. What is the sequence of the daughter strand produced from this sequencing activity? Show the process. The following piece of DNA is sequenced using the dideoxy method: 3’-AAGCGGCTAATCC-5’. Accidentally, you forget to include dATP in the four reactions that contain a ddNTP. How many bands will appear in the lane containing ddATP? Show the process. The following piece of DNA is sequenced using the dideoxy method: 3’-AAGCGGCTAATCC-5’.…The chain terminator method was used to sequence the following DNA fragment: ACTGGGCATAAGCGGGAACTTTGCAGAACTGGCTGGCCTCAGAGCAGGGA. 1. Predict a band pattern in a gel after sequencing this DNA fragment using a radioactively labeled primer [32P]-5’- TCTGAGGCCAGCCAGTTCTGCAAAGTTC. 2. Due to an experimental mistake, dATP was not added in all four reaction mixtures. How does the band pattern change?