Explain o In Prokaryotes, what is the function of the5'UTR?A. It contains the start codonB. It contains the stop codonC. If contains the terminator sequenceD. It contains sequences needed forribosome bindingE. It codes for the 1st exon

The 5′ untranslated region (5′ UTR) is the region of an mRNA that is directly upstream from the…

o In Prokaryotes, what is the function of the 5'UTR? A. It contains the start codon It contains the stop codon C. It contains the terminator sequence В. D. It contains sequences needed for ribosome binding E. If codes for the 1st exon

o In Prokaryotes, what is the function of the 5'UTR? A. It contains the start codon It contains the stop codon C. It contains the terminator sequence В. D. It contains sequences needed for ribosome binding E. If codes for the 1st exon

BIOLOGY:CONCEPTS+APPL.(LOOSELEAF)

10th Edition

ISBN:9781305967359

Author:STARR

Publisher:STARR

Chapter9: From Dna To Protein

Section: Chapter Questions

Problem 11SA: _______ are removed from new mRNAs. a. Introns c. Poly-A tails b. Exons d. Amino acids

See similar textbooks

Related questions

Q: Suppose that a gene underwent a mutation that changed a GAA codon to UAA. (a) Name the amino acid…

A: Mutation is the sudden heritable changes that occur in the DNA sequences due to error while…

Q: In catalyzing the methylation or pseudouridylation of an rRNA, asnoRNA functions asa. a decoy.b. a…

A: SnoRNA (small nucleolar RNA) is abundantly present in nucleolus and carries the modification of…

Q: The function of RNA polymerase is to A) catalyze the formation of phosphodiester bonds between…

A: Gene expression is the process thorough which the DNA directs to form proteins. It involves two…

Q: Evaluate the following statements. Which one statement is false?

A: Answer: Central Dogma : It is the complete process of replication , transcription and translation of…

Q: Once a peptide bond has been formed between the amino acid attached to the TRNA in the P site and…

A: To find The process what occurs next once a peptide bond has been formed between the amino acid…

Q: Explain why cell biologists predicted that the genetic code would be based on a 3-base codon.…

A: The genetic code is the precise sequence of DNA nucleotides read as three-letter words or codons…

Q: Many antibiotic drugs work by interfering with protein synthesis in bacteria that cause infection.…

A: Protein synthesis occurs through Ribosomes and mRNA and tRNA .The tRNA bound with amino acid reaches…

Q: The anticodons are located in a.tRNA. b.rRNA. c.mRNA. d.ribosomes. e.endoplasmic reticulum.

A: Anticodons- An anticodon is a trinucleotide sequence complementary to that of a corresponding codon…

Q: How are rare bases incorporated into tRNAs? a. Encoded by guide RNAs b. By chemical changes to one…

A: RNA contains four types of nucleotides adenine, guanine, cytosine, and uracil. In addition to these…

Q: . Suppose that a gene underwent a mutation that changed a GAA codon to UAA. (a) Name the amino acid…

A: A codon is a sequence of three DNA or RNA nucleotides that corresponds with a specific amino acid or…

Q: In the chain elongation of proteins, the new aminoacyl-tRNA bonds to? a.A site b.E site c.G site…

A: Translation is process by which the cells produce protein from the information provided by the DNA.…

Q: Which would be worse for an organism? Briefly explain your answer. B. The spliceosome can no longer…

A: Cell is the basic and fundamental unit of life. Survibility of life depend upon individual cells…

Q: 44

A: The given structure is of tRNA molecule which is an adapter molecules for amino acid synthesis.

Q: If you want to express a eukaryotic gene in a bacterial cell, you ned to (select all that apply):…

A: The gene is a basic physical and functional unit of heredity. Genes are made up of DNA.The gene is a…

Q: The wobble position of codons occurs A. before the 2nd base B. after the ribosome initiates a stop…

A: Question - The wobble position of codons occurs A. before the 2nd base B. after the ribosome…

Q: a. The right side shows the ribosome with an empty A site aligned with the codon 5’UAU 3’. The next…

A: When the DNA that is already transcribed to RNA inside the cell ribosomes helps this mRNA to…

Q: What is the genetic code? a. The relationship between a three-base codon sequence and an amino acid…

A: Translation is the process of conversion of an mRNA (messenger RNA) molecule into a functional…

Q: The IRNA that was in the P site moves into the A site C. The tRNA that was in the A site moves to…

A: The process of protein synthesis is called translation. In this process transfer RNA, messenger RNA…

Q: Choose best match of the events that occur during translation with their locations in the E. coli…

A: Translation is the process by which the genetic code on messenger RNA (mRNA) molecules is decoded to…

Q: Ribosomes that are translating a mRNA, would release that mRNA when they reach a) an operator b) a…

A: Introduction :- Ribosomes have two primary functions: message decoding and peptide bond synthesis.…

Q: Given the codon UCA in the first exon of a gene, which change is most likely to result in a nonsense…

A: A nonsense mutation is one in which change in nucleotide will result in a stop codon. This will…

Q: The tRNA for Phe binds to the mRNA codon UUU. You mutate the anticodon of the Phe-tRNA from AAA to…

A: RNA is the nucleic acids similar to the DNA and contains uracil instead of the thymine. It plays…

Q: Which is true about eukaryotic cDNA? Choose all that apply a. it is single stranded b. it is made…

A: Complementary DNA is abbreviated as cDNA. This form of DNA has a wide range of applications. Genes…

Q: Transfer RNA ____________________. a. Carries amino acids to the ribosome b. Carries information…

A: The RNA is a biopolymer and the existence of complementary sequences on the RNA strand ensures that…

Q: The AUC and AUA codons in mRNA both specify isoleucine. What feature of the genetic code explains…

A: The process of formation of mRNA(messenger ribonucleic acid) molecules on the DNA(deoxyribonucleic…

Q: In one (1) sentence point out a key functional similarity and difference in each of the pair of…

A: Amino acids are the building blocks of proteins that are classified as acidic, basic, and Amino…

Q: Which part of a tRNA molecule acts as an amino acid attachment site? a. the 5' end b.…

A: tRNA (transfer ribonucleic acid) molecule escorts amino acids to their correct location in a…

Q: Put the events of translation in order. A. Ribosome reads the start codon and initites…

A: Translation is the process of peptide synthesis in any living organism. It involves the ribosome…

Q: d. Between which two regions on the DNA will the polyadenylation signal be found? Use the numbers to…

A: Deoxyribonucleic acid is also known as DNA and ribonucleic acid also known as RNA are two types of…

Q: what is the genetic code and explain the properties

A: Hi! Thanks for your question. But as you have posted multiple subpart questions, I am answering the…

Q: TRNAS contain the that interacts with MRNA. docking bay b. anticodon а. C. codon

A: A transfer RNA is an adaptor molecule made of RNA that is typically 76 to 90 nucleotides long (in…

Q: A release factor is referred to as a “molecular mimic” because its structure is similar to a. a…

A: Translation is a process of translating the sequence of messenger RNA molecule to amino acid…

Q: Transfer RNA is the molecule thata. contributes to the structure of ribosomesb. adapts the genetic…

A: There are two types of nucleic acids. RNA and DNA. RNA stands for ribonucleic acid. There are three…

Q: how does the E.coli ribosome find the RNA to be translated? A. the sigma factor B. the shine-…

A: SHINE DALGARNO SEQUENCE The ribosome binds to the ribosomal binding site present on messenger RNA in…

Q: A segment of DNA has the followimg sequence of bases.. 5'-ATGCAATGATATTGAAGCTTA-3' a) What…

A: Translation is the mechanism by which ribosomes in the cytoplasm or endoplasmic reticulum synthesize…

Q: In a polyribosome, the polypeptides associated with which ribosomes will be the longest? a. Those at…

A: Ribosomes are involved in translation by building proteins from amino acids using messenger RNA as a…

Q: In elongation, the creation of peptide bonds between amino acids is catalyzed by a. rRNA. b. a…

A: We know that the process of translation involves formation of protein from the mRNA (messenger…

Q: Enzymes, proteins and deoxyribonucleic acid (DNA) are important biological macromolecules. Enzymes…

A: Protein synthesis is the process where cells make proteins and occurs in two stages: transcription…

Q: What site on the ribosome is the place where a tRNA molecule leaves the ribosome after attaching its…

A: BASIC INFORMATION TRANSLATION It is the process in which protein is which formed from the…

Q: What molecule/feature ensures that the correct amino acid is added to the peptide chain with reading…

A: The process in which the mRNA is converted into the proteins buy the help of particular codon is…

Q: The job of tRNA is to O A. bring amino acids to the ribosome by matching their anticodon to the…

A: The genetic material is used to store the genetic information in the mitochondria or nuclei of an…

Q: During translation

A: The translation involves the synthesizing proteins through ribosomes in the cytoplasm or endoplasmic…

Q: . To attach to viral sequences b. To weigh down mRNA c. To terminate translation…

A: The purpose of a Poly-A tail being added to mRNA is to terminate translation. The polyA tail is a…

Q: When would a ribosome bind to a promoter sequence? A) It wouldn't. A promoter is a DNA sequence, and…

A: Ribosomes bind to mRNA during the process of translation. Initiation of protein synthesis involves…

Q: Which statement regarding UTRs is TRUE? a) Transcription begins at the start of the 5' UTR b)…

A: UTR stands for untranslated region in mRNA.

Q: The site on the ribosome complex which binds the new incoming amino acid- TRNA is called the A P…

A: Introduction Translation is the process by which ribosomes in the cytoplasm or endoplasmic reticulum…

Q: how does eukaryotic ribosome find the mRNA to be translated? A. the sigma factor B. the…

A: the 5' cap

Concept explainers

Immune Disorders

The collaboration between the cells and proteins that work together as a defense system against infection comprises the immune system.Each of them performs a variety of tasks to recognize and/or react against a foreign body.

Question

Explain

o In Prokaryotes, what is the function of the
5'UTR?
A. It contains the start codon
B. It contains the stop codon
C. If contains the terminator sequence
D. It contains sequences needed for
ribosome binding
E. It codes for the 1st exon

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Step 3

VIEW

Trending now

This is a popular solution!

Step by step

Solved in 3 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

Yeast have 8 similar tRNA genes with the anticodon 5'-GUA. A researcher mutates one of these genes to change its anticodon to 5'-GUU. a) What codon did the tRNA originally decode? Name the amino acid. b) What codon does the mutated tRNA decode? Name the amino acid.
The codon UUU in an mRNA molecule which results in phenylalanine being inserted as the protein is made. Which will be a characteristic of this codon? a. The tRNA molecule that binds to the UUU codon must have an AAA anticodon. Nde ba e2? b. UUU could code for both phenylalanine and alanine during translation. c. The aminoacyl-tRNA synthetase for phenylalanine binds only the UUU codon. d. UUU is probably only one of several codons that code for phenylalanine.
Where does mRNA/tRNA codon-anticodon recognition take place? a)40S b)50S c)The surface between the two ribosomal subunits d)30S
Which of these features is found in eukaryotes but not bacteria?a. polygene mRNAs b. introns c. stop codon d. AUG codon
The following video shows the translation process in eukaryotes. https://www.youtube.com/watch?v=qIwrhUrvX-k Based on the video, which signal serves a similar function as the Shine-Dalgarno Sequence in prokaryotes? A. The promoter region B. 5' CAP C. Poly(A) tail D. Start codon
In the chain elongation of proteins, the new aminoacyl-tRNA bonds to? a.A site b.E site c.G site d.P site
Some mitochondria use a second codon, in addition to AUG, to specify Met. Which codon(s) is (are) most likely to be used this way?
Template strand of DNA is: 3’ TACATAACCGGGCCCATATCGGCCATTTGC5’. 2a). Following transcription, what is the total number of codons in the mRNA transcript? 2 b). Where is the start codon located in this mRNA transcript? 2c). Following translation of this mRNA transcript, how many amino acids will the proteincontain and identify the amino acids sequence of this gene from a genetic code table*.*Note= using a genetic code table
The anticodon loop of one of the tRNA Gly molecules from Escherichia coli is as follows: a) Identify the anticodon, reading from 3’ to 5’. b) This tRNA recognizes a Gly codon. What is it? Write it from 5’ to 3’.
tRNAs contain the ________ that interacts with mRNA. a. docking bay b. anticodon c. codon
Part A) In your own words describe what happens in transcription and translation Include which types of nucleic acids are involved in each step Describe the function of each type of nucleic acid in the process of making proteins Part B) Also, explain how two nucleic acids "recognize" or "talk" to each other
Transcribe the DNA strand given above to write the sequence of the mRNA strand in the 5’ to 3’ direction. Use the table and write the sequence of the resulting peptide. Is it possible for a codon to code for another amino acid? What will be the effect if a mutation changes the codon UAU to UAA? What is a reading frame? If you are given a nucleotide sequence, how would you find Open Reading Frames? DISCUSS the reason why there are leading and lagging strands in replication?