Q: put in correct order the steps for initiating translation. 1. Binding of initiator tRNA to mRNA 2.…
A: The translation is the process by which cells make proteins. Here, the mRNA formed by transcription…
Q: Treating a cell with a drug to stop tRNA from doing its job would mean what? A. that ribosomes…
A: Protein synthesis is a complex process involving lots of small and large factors, which all need to…
Q: The two-dimensional structures of mRNA, tRNA, and rRNA are shown in the diagrams. Which of the…
A: The primary function of rRNA is the synthesis of proteins by binding to mRNA and tRNA to ensure the…
Q: Briefly describe the function of the following in protein synthesis: a) rRNA, b) tRNA c) mRNA
A: Translation is the process by which proteins are synthesized by joining of amino acid using mRNA and…
Q: According to the adaptor hypothesis, is each of the following statements true or false? A. The…
A: Codons are the triplet nucleotide sequences either of RNA or DNA, which helps in binding specific…
Q: Use your DNA strand to construct a part of a messenger RNA molecule. DNA A G T…
A: When DNA is converted into mRNA then this process is called transcription.Transcription occurs in…
Q: You are studying a human cancer cell line and you notice that you see the normal amount of RNA but…
A: INTRODUCTION Mutation Mutations are the sudden heritable changes in the genetic material occur due…
Q: Check your understanding about the following statements: I. Messenger RNA is a single-stranded…
A: Every living organisms contain DNA as the genetic material. It is a double stranded molecule that is…
Q: Which of the following statements about the nucleolus is not true? a. The nucleolus is a…
A: The nucleolus is the distinct structure present in the nucleus of eukaryotic cells. Primarily, it…
Q: As with all biomolecules, rRNA has a structure that directly relates to its function. Which…
A: Ribosomal RNA or rRNA is a ribozyme that catalyzes the synthesis of proteins. This non-coding RNA…
Q: RNA has many functions in a cell. Besides mRNA, which carries information from the genome to the…
A: RNA is a nucleic acid which is present in all living cells. It has structural similarities to DNA…
Q: Consider the gene that encodes telomerase RNA. Suppose that the sequence of the template strand that…
A: DNA is composed of nucleotides. There are two purine bases - -Adenosine (A), and Guanine (G), and…
Q: You are a research scientist working in genetic engineering. You create a piece of DNA that you want…
A: Because of the remarkable efficiency with which DNA molecules are introduced into cells, E. coli is…
Q: o In Prokaryotes, what is the function of the 5'UTR? A. It contains the start codon It contains the…
A: The 5′ untranslated region (5′ UTR) is the region of an mRNA that is directly upstream from the…
Q: mRNA Comparison A scientist studies the production of a key digestive enzyme in silk moths. The…
A: Silkworm (Bombyx mori) larvae that are used for silk production are mainly fed on mulberry leaves.…
Q: Put the following steps of protein synthesis in order: STEP A - Anticodon attaches to the mRNA STEP…
A:
Q: Q. Ribosomes are “ribonucloprotein particles” in that they are composed mostly of rRNA with some…
A: Ribosomal proteins are made in the cytoplasm and then transported to the nucleus where they are…
Q: Which of the following plays a major part in determining whether or not RNA polymerase will…
A: RNA polymerase is an enzyme that helps to convert a DNA sequence into an RNA sequence in the…
Q: ) The deacetylation of histones generally causes gene inactivation. True or false?
A: Since you have asked multiple question, we will solve the first question for you. If you want any…
Q: Compare and contrast the process of protein synthesis in bacterial and eukaryotic cells, giving…
A: The central dogma of biology explains the flow of information from genes to protein by two…
Q: As with all biomolecules, rRNA has a structure that directly relates to its function. Which…
A: To determine: In all biomolecules, which describes the relationship between structure and function…
Q: scientist observing a cell during gene expression would be able to easily distinguish it as a…
A: Transcription The process in which DNA molecules is coded into mRNA with the help of enzymes.
Q: Which of the following statements below is incorrect? * A. the genetic code is overlapping B.…
A: As per guidelines, you have asked multiple questions we will solve the first question for you. If…
Q: 2. Next, directly below the new DNA sequence that you gave for #1, write/type the nucleotide…
A: 2. DNA and RNA are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid…
Q: describe how a protein is processed that is going to end up as a lysosomal enzyme. Start with the…
A: Proteins- Proteins are building blocks of every life. We have proteins in every cell. It is made up…
Q: Step 2- Draw (DO NOT COPY-PASTE Images from the Internet) a picture of what is happening in each…
A: Dr. Francis Crick gave the central dogma of molecular biology which states that the information…
Q: Discuss why you think the ribosomes need to contain so many proteins and rRNA molecules. Does it…
A: Ribosomes are present in both plant and animal cells. they are present in both prokaryotic and…
Q: Translation is a process which is best symbolized by a. RNA --> DNA b. DNA --> RNA c.…
A:
Q: Which sequence best represents the correct order of these stages? 2-1-3-4 2-3-1-4…
A: The Central dogma of molecular biology suggest that the expression of the genes occurs in the three…
Q: Imagine that you and your colleagues are working in a lab to develop a protein synthesis system for…
A: The mRNA in prokaryotes is polycistronic, while the mRNA in eukaryotes is monocistronic.…
Q: Diagram generally how a mRNA that contains sequences corresponding to four (4) exons would be…
A: In eukaryotes, genetic information is encoded in DNA is transcribed first as pre-mRNA strand. This…
Q: What is the role of ribosomes in protein synthesis? * A. they carry proteins to the site of action…
A: Protein synthesis takes place in the cytoplasm. The mRNA is read in the pair of three bases at a…
Q: You are a research scientist working in genetic engineering. You create a piece of DNA that you want…
A: Gene expression is a phenotypic expression of genes through writing and translation processes.…
Q: Which of the following is true of phase variation? A) O It is triggered by stalled ribosomes. B) O…
A: Phase variation is a feature seen in Salmonella, in which it can withstand unfavorable environmental…
Q: Step 2- Draw (DO NOT COPY-PASTE Images from the Internet) a picture of what is happening in each…
A: Transcription is the process that reads and converts the messages on the DNA template strand into…
Q: Write an essay below to describe the process by which mRNA is formed. Use these terms correctly in…
A: Transcription of DNA into mRNA and translation of mRNA into protein is known as the central dogma of…
Q: The characteristic way in which the DNA molecule is copied to form mRNA is most related to: a) the…
A: Introduction Transcription takes place in the nucleus, During transcription, It uses DNA as a…
Q: central dogma of molecular biology describe the flow of information in the cell.There are also…
A: Central dogma is invented by fransic Crick in 1958. Which explains the flow of genetic information.…
Q: Part A) In your own words describe what happens in transcription and translation Include which…
A: DNA(Deoxyribonucleic acid) is defined as type of double helical molecule composed of two…
Q: Enzymes, proteins and deoxyribonucleic acid (DNA) are important biological macromolecules. Enzymes…
A: Protein synthesis is the process where cells make proteins and occurs in two stages: transcription…
Q: Determine each of the following items using the hnRNA nucleotide sequence (enter the answer using…
A: “Since you have asked multiple questions, we will solve the first question for you. If you want any…
Q: The job of tRNA is to O A. bring amino acids to the ribosome by matching their anticodon to the…
A: The genetic material is used to store the genetic information in the mitochondria or nuclei of an…
Q: A. Label each structure as mature mRNA, pre-mRNA, protein, or DNA. B. Label each arrow to indicate…
A: The central dogma depicts the replication of DNA, the transcription of DNA into RNA, and the…
Q: When would a ribosome bind to a promoter sequence? A) It wouldn't. A promoter is a DNA sequence, and…
A: Ribosomes bind to mRNA during the process of translation. Initiation of protein synthesis involves…
Q: Draw a schematic diagram for RNA (a) transcription and (b) translation then label organelles,…
A: A. Transcription is a synthesis of RNA with the help of the template strand of the DNA. B.…
Q: The information in DNA is used by cells to produce proteins that perform various functions in cells.…
A: Transcription is the formation of a sequence of RNA using DNA as a template and DNA dependent RNA…
Q: When the ribosome "reads" the codon UAG, UGA or UAA... A) the polypeptide is released from ribosome…
A: Ribonucleic acid (RNA) is a nucleic acid found in both the nucleus and cytoplasm. It can be genetic…
Gene Interactions
When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.
Gene Expression
Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.
During translation
(a) topoisomerase binds to the DNA (b) RNA polymerase binds to the promoter (c) helicase unwind the DNA (d) mRNA forms a stem loop structure (e) the two subunits of the ribosome join together
Step by step
Solved in 4 steps
- Which statement is true of the translocation phase of elongation during protein synthesis? a. The empty tRNA moves to the A site of the ribosomal complex. b. The empty tRNA moves to the T site of the ribosomal complex. c. The dipeptide moves from the A site to the P site of the ribosomal complex. d. The dipeptide moves from the P site to the A site of the ribosomal complex.Discuss why you think the ribosomes need to contain so many proteins and rRNA molecules. Does it seem like a waste of cellular energy to make such a large structure so that translation can occur?Which of the following best describes tRNA? a. Provides the instructions for the amino acid sequence of a polypeptide b. Complexes with ribosomal proteins to form ribosomes c. Used for eukaryotic RNA processing d. Transports amino acids to ribosomes during translation
- What is the role of ribosomes in protein synthesis? * A. they carry proteins to the site of action B. they provide a source of amino acids C. they provide a site from tRNAs to link to mRNAs D. they translate the basic DNA code using tRNA Consider the following DNA bases sequence 3' TAT CGG 5'. what dipeptide is formed if a DNA point mutation converts CGG to CGT? * A. Val-Ala B. Asp-Glu C. Ala- Ala D. Gly-Ala A tRNA molecule possesses the anticodon 5' CGU 3' , which amino acid will this tRNA molecule carry? * A. Threonine B. Valine C. Alanine D. Arginine What will most likely be the effect of the change in the DNA molecule? * A. the change will cause a harmful mutation B. the DNA molecule will be unable to replicate…if the following DNA sequence were transcribed, which of the following describes the output of this process? 3'- TCTGGACA-5' A. This would produce a protein that looks like 5'- A G A C C U G U -3' B. This would produce a tRNA that looks like 3'- A G AC C U G U -5' C. This would produce an mRNA that looks like this: 5'- A G AC C U G U -3' D. This would produce an mRNA that looks like 3'- U C U G G A CA -5' E. This would produce another strand of DNA that 0ok like 5-AG ACCT GT-3. ..Explain, in detail, the process of DNA replication. Include in your answer, a diagram, the cellular location and reason for DNA replication, the names of all enzymes/molecules involved, and the sequence of events. a. Explain, in detail, the process of mRNA translation. Include in your answer, a diagram, the cellular location and reason for translation, the names of all enzymes/molecules/sites involved, and the sequence of events. Please help explain in fewer than 8 sentences!
- Is mRNA +sense, –sense, or a mixture of the 2? What about DNA? Which best describes the template strand used by cellular RNA polymerase?A single template strand of a DNA molecule is represented by 3’atgtaccatgcgcaaatttaaaggccc5’. a) Imagine that AAG is an INTRON in the original DNA template strand above. Write the mature mRNA strand after the three modifications? b) Write the amino acid sequence of your mature mRNA. c) List the molecules involved in translation and briefly describe their function.Diagram generally how a mRNA that contains sequences corresponding to four (4) exons would be translated. How many domains would the protein that results from translation contain?
- f you made a change in the promoter sequence in the DNA that inactivates the promoter, what would happen at the RNA level? A-Nothing, because the RNA would be made as usual B-Transcription factors would be unable to bind and the RNA polymerase would not be recruited to the DNA, so no RNA would be made. C-The mutation of the DNA would be carried through to the RNA sequence. D-The DNA helicase would not be able to recognize and bind the DNA, so the RNA would not be made. EXPLAIN WHY THE ANSWER YOU CHOOSE IS CORRECTEach of the following statements about protein synthesis is false.Correct each to make a true statement. a. In a gene, each nucleotide specifies one amino acid in a protein sequence. b. A transcription factor must bind to the promoter region of a gene before the enzyme DNA synthetase is able to bind and begin transcription. c. The enzyme RNA polymerase builds a strand of transfer RNA, whose codons are complementary to DNA’s triplets. d. Proteins destined for secretion from the cell enter the nucleus after translation, to be folded and modified. e. During translation, amino acids are delivered by the messenger RNA transcripIn detail, describe how a protein is processed that is going to end up as a lysosomal enzyme. Start with the Ribosome and mRNA and end with the lysosome.