Put the events of translation in order. A. Ribosome reads the start codon and initites transcription B. The ribosome recruits the correct tRNA to its binding site. C. Peptide bond occurs betweeen two amino acids D. The "empty" tRNA leaves the ribosomes
Q: Which of the following is NOT true regarding the genetic code and translation? a) An mRNA is…
A: Deoxyribonucleic acid or DNA is a type of nucleic acid that is present in the nucleus of the cell.…
Q: The ribosome binds to the mRNA molecule to start translation of its code into a protein. What…
A: Step 1 The translation is the process in which the coded genetic message brought by mRNA (messenger…
Q: If a tRNA molecule has an anticodon which reads AUG what was the codon of the mRNA MOLECULE
A: tRNA is also called a transfer RNA. It is a secondary structure of RNA having stem loops. It is a…
Q: Once a peptide bond has been formed between the amino acid attached to the TRNA in the P site and…
A: To find The process what occurs next once a peptide bond has been formed between the amino acid…
Q: Explain the how translation is initiated in ribosome.
A: It is the process by which a protein is synthesized from the information contained in a molecule of…
Q: Spliceosomes play central roles in .. a) removal of exons from pre-mRNA b) removal of introns from…
A: The mRNA transcribed from the DNA is heterogeneous mRNa or pre mRna which is not the final product.…
Q: During translation, small organelles called ____ read the mRNA sequence. These organelles direct…
A: Protein synthesis is a complex process and requires sequential steps of transcription and…
Q: The law of complementary base pairingdescribes the way the bases in an mRNAcodon pair up with the…
A: Translation is a process in which the messenger RNA or mRNA gets translated into protein. The…
Q: Which enzyme links amino acids to the 3’ OH group of an RNA? (a) ribozyme (b) peptidyl…
A: The translation is a process of converting mRNA molecules to amino acids which take place in the…
Q: Which of the following best describes mRNA? Group of answer choices a) Complexes with ribosomal…
A: RNAs are produced as a result of transcription process.
Q: To begin translation, the small subunit of the ribosome starts moving down an mRNA. What feature…
A: INTRODUCTION Translation Translation is the process of conversion of mRNA into protein. It consist…
Q: Explain Circular structure of mRNA increases translation efficiency with the help of diagram.
A: mRNA or messenger RNA is a single-stranded RNA molecule that is read by the ribosome for the…
Q: Some events that take place in proteins synthesis are shown below: A. peptide bonds are formed B. a…
A: Protein synthesis involves transcription and translation. Transcription involves three steps…
Q: Which of the following best describes tRNA? a. Provides the instructions for the amino acid…
A: Translation is the process of formation of amino acids from mRNA sequence.
Q: Considering the given sequence of nucleotides in an mRNA molecule, (a) what is the sequence of the…
A: Gene expression is the process by which the instructions in the DNA are converted to functional…
Q: During translation, when a stop codon is read on the mRNA strand at the ribosome... a the mRNA is…
A: Activation (getting ready), initiation (getting started), elongation (getting longer), and…
Q: Some events that take place in proteins synthesis are shown below: A. An enzyme reads the gene…
A: TRANSCRIPTION It is the process of transfer of sequence information from DNA to RNA . The DNA…
Q: Compare and contrast the processes of transcription and translation
A: Deoxyribonucleic acid (DNA) is a molecule comprised of two polynucleotide chains coiled around each…
Q: If a sequence of bases on a DNA molecule is GATTACA, what would the complimentary mRNA strand look…
A: DNA replication is the process of the formation of identical copies of DNA.It occurs in nucleus.…
Q: A single template strand of a DNA molecule is represented by 3’atgtaccatgcgcaaatttaaaggccc5’. a)…
A: The transcription is the process in which the mRNA copied information from DNA for protein…
Q: Ribosomes that are translating a mRNA, would release that mRNA when they reach a) an operator b) a…
A: Introduction :- Ribosomes have two primary functions: message decoding and peptide bond synthesis.…
Q: _____________ are molecular machines that excise introns from pre-mRNA and then join exons together.
A: In eukaryotes, the RNA transcript that is formed by transcribing a DNA molecule is termed pre-mRNA…
Q: Describe the roles of ribosome, mRNA & tRNA 's in translation
A: Introduction :- The mRNA contains a series of codons that the ribosome decodes to produce the…
Q: Diagram generally how a mRNA that contains sequences corresponding to four (4) exons would be…
A: In eukaryotes, genetic information is encoded in DNA is transcribed first as pre-mRNA strand. This…
Q: What is the role of ribosomes in protein synthesis? * A. they carry proteins to the site of action…
A: Protein synthesis takes place in the cytoplasm. The mRNA is read in the pair of three bases at a…
Q: Which of the following best describes the role of RNA polymerase in a cell? O A. It initiates…
A: DNA ( Deoxyribonucleic acid ) is a genetic material which is two stranded structure that helps in…
Q: After the ribosome slides along the mRNA, the dipeptide will be attached to the tRNA in the ________…
A: The RNA molecule transition ribonucleic acid (tRNA) assists in the translation of a messenger RNA…
Q: Describe the process of translation. In your answer: a. Describe the structure of mRNA and identify…
A: The translation is a process that is carried out in the cytoplasm. In this process, mRNA is…
Q: . Translation a)Explain the role of ribosomes in the process of protein translation.b. Explain the…
A: “Since you have asked a question with multiple sub-parts, we will solve the first three sub-parts…
Q: The formation of peptide bonds between amino acids occurs _____. a. during transcription b.…
A: Translation involves “decoding” a messenger RNA (mRNA) and using its information to build a…
Q: After transcription, the molecule that is formed is a.complementary to part of one strand of DNA.…
A: Transcription is the process that is catalyzed by the RNA Polymerase enzyme. In this process a…
Q: The amino acid pool used in translation is found in: a. the cytosol b. in the Golgi apparatus c. in…
A: The amino acid pool used in translation.
Q: what is the genetic code and explain the properties
A: Hi! Thanks for your question. But as you have posted multiple subpart questions, I am answering the…
Q: Messenger RNA ____________________. a. Carries amino acids to the ribosome b. Carries information…
A: DNA is converted into mRNA, this process is known as transcription. mRNA is converted into protein,…
Q: A release factor is referred to as a “molecular mimic” because its structure is similar to a. a…
A: Translation is a process of translating the sequence of messenger RNA molecule to amino acid…
Q: (a) Write the complementary base sequence for the matching strand in the DNA section shown below:.…
A: Introduction According to Chargaff's rules, DNA from any cell of any organism should have a 1:1…
Q: A segment of DNA has the followimg sequence of bases.. 5'-ATGCAATGATATTGAAGCTTA-3' a) What…
A: Translation is the mechanism by which ribosomes in the cytoplasm or endoplasmic reticulum synthesize…
Q: Which of the following is not true of a codon?(A) It may code for the same amino acid as another…
A: The genetic code involves the set of rules determining the conversion of nucleotide sequence into a…
Q: In a polyribosome, the polypeptides associated with which ribosomes will be the longest? a. Those at…
A: Ribosomes are involved in translation by building proteins from amino acids using messenger RNA as a…
Q: Enzymes, proteins and deoxyribonucleic acid (DNA) are important biological macromolecules. Enzymes…
A: Protein synthesis is the process where cells make proteins and occurs in two stages: transcription…
Q: What molecule/feature ensures that the correct amino acid is added to the peptide chain with reading…
A: The process in which the mRNA is converted into the proteins buy the help of particular codon is…
Q: Which statement is true of the translocation phase of elongation during protein synthesis? a. The…
A: The translation is the process by which ribosome synthesis protein using mRNA. It consists of three…
Q: Explain the roles of mRNA, tRNA, and rRNA in translation.
A: Ribonucleic acids (RNAs) are one of the important components of cells. It is involved in protein…
Q: The job of tRNA is to O A. bring amino acids to the ribosome by matching their anticodon to the…
A: The genetic material is used to store the genetic information in the mitochondria or nuclei of an…
Q: A particular tRNA is mutated so that the amino acid attachment cannot bind with the aminoacyl-tRNA…
A: Protein synthesis happens by a series of events. mRNA transcripted from DNA had the codons. tRNA has…
Q: When the ribosome "reads" the codon UAG, UGA or UAA... A) the polypeptide is released from ribosome…
A: Ribonucleic acid (RNA) is a nucleic acid found in both the nucleus and cytoplasm. It can be genetic…
Put the events of translation in order.
A. Ribosome reads the start codon and initites transcription
B. The ribosome recruits the correct tRNA to its binding site.
C. Peptide bond occurs betweeen two amino acids
D. The "empty" tRNA leaves the ribosomes
Step by step
Solved in 3 steps
- _______ are removed from new mRNAs. a. Introns c. Poly-A tails b. Exons d. Amino acidsA single template strand of a DNA molecule is represented by 3’atgtaccatgcgcaaatttaaaggccc5’. a) Imagine that AAG is an INTRON in the original DNA template strand above. Write the mature mRNA strand after the three modifications? b) Write the amino acid sequence of your mature mRNA. c) List the molecules involved in translation and briefly describe their function.1. Translation a)Explain the role of ribosomes in the process of protein translation.b. Explain the role of tRNA molecules in protein translation.c. Define the following terms:1. codon 2. anticodon. Explain how a codon is used in the process of translation.
- Which of the following best describes mRNA?Group of answer choices a) Complexes with ribosomal proteins to form ribosomes b) Transports amino acids to ribosomes during translation c) Provides the instructions for the amino acid sequence of a polypeptide d) Used for eukaryotic RNA processingA particular tRNA is mutated so that the amino acid attachment cannot bind with the aminoacyl-tRNA synthase. What happens when an mRNA transcript contains the codon for this tRNA? A. The tRNA will not bind to this codon. B. Translation stops and the protein is released. C The wrong tRNA is added to the protein chain. D. Translation stops and the protein remains bound to the ribosome.Which of the following best describes tRNA? a. Provides the instructions for the amino acid sequence of a polypeptide b. Complexes with ribosomal proteins to form ribosomes c. Used for eukaryotic RNA processing d. Transports amino acids to ribosomes during translation
- What is the genetic code? a. The relationship between a three-base codon sequence and an amino acid or the end of translation b. The entire base sequence of an mRNA molecule c. The entire sequence from the promoter to the terminator of a gene d. The binding of tRNA to mRNADuring translation, the codon in mRNA is actually “read” by a. the A site in the ribosome. b. the P site in the ribosome. c. the anticodon in a tRNA. d. the anticodon in an amino acid.Part A) In your own words describe what happens in transcription and translation Include which types of nucleic acids are involved in each step Describe the function of each type of nucleic acid in the process of making proteins Part B) Also, explain how two nucleic acids "recognize" or "talk" to each other
- Translation of the dna sequence AAGCTGGGA would result in: A) a DNA strand with the base sequence TTCGACCCT B) an mRNA strand with the sequence TTCGACCCT C) a sequence of three amino acids linked by peptide bonds D) an mRNA strand with the sequence UUGCACCCU(a) Write the complementary base sequence for the matching strand in the DNA section shown below:. 5’ – A T G T T A C T A G T C – 3’ (b) The following section of DNA is used to build an mRNA for a protein: 3′—AAG—CTT—CTC—5′. What is the corresponding mRNA sequence?Translation of mRNA is terminated at the stop codon by: A. binding of the Release Factor to stop codon B. tRNA binding to the E site C. tRNA that recruits a release factor D. tRNA that recognizes a stop codon
