Of the circled parts, indicate which numbers is/are parenchyma cells 1

Q: of Traits and Species Rhesus Snapping Kangaroo Lamprey Bullfrog Human Tuna Monkey Turtle Dorsal…

A: Cladogram A cladogram is the phylogenetic tree representation that depicts the evolutionary…

Q: 5' GTGCTAGCGGGAATGAGCTGGGATACTAGTAGGGCT 3 33' САCGATCGCCCTTACТCGАСССТАТGATCАТССCGA 5' Template…

A: The DNA or deoxyribonucleic acid is the genetic material in living organisms. DNA contain genes that…

Q: Design 6 bp primers to amplify the region of this sequence that is highlighted in yellow. 1…

A: Primers:  Short nucleotide sequences usually 6-10 bp in size that acts as the initiation point for…

Q: Explain what is meant by the statement "Metabotropic receptors act via second messengers."

A: Metabotropic receptors: Metabotropic receptors is also known as G-protein coupled receptor that…

Q: Strain X. spp. is a rod-shaped, anaerobic, Gram-positive bacterium with peritrichous flagella and…

A: Given information   Doubling time 240 minutes = 4 hours. Initial population = 10 cells Final…

Q: 6.3.7 Activity 6.1 2 List and briefly explain four methods of studying an E-S complex. ngenic…

A: Answer :- 1) There are various methods of studying the Enzyme-substrate complex like magnetic…

Q: List some of the variations in eudicot leaf structure.

A: Eudicots are dicotyledons which means plants have two cotyledons in their seeds. Monocots are plants…

Q: explain the relationship between biological race, ancestry, and socially defined race

A: Classification of organisms is done using morphological, physiological, and molecular data along…

Q: ACTIVITY 12 - LIPIDS As you watch the video, take notes about what you are learning about lipids.…

A: Introduction A lipid is any of several chemical molecules that are water insoluble. They are…

Q: d. Name of organism: Features used to ID:

A: Please follow step 2 for detailed explanation.

Q: How do antibodies work to eradicate pathogens?

A: Antibodies can be referred to as specialized Y-shaped proteins which have the ability to degrade the…

Q: You have counted a total of 6.4 x 10° cells /ml in preparation for plating cells at a concentration…

A: The answer is  1.17 mL of cells and 3.83 mL of medium

Q: How does the body metabolized fat?

A: Fats or lipids enter the body through the food that we eat. There are many sources of lipids like…

Q: To explain: Why do seedlings that germinate in a fully darkened room grow taller than seedlings of…

A: Every living thing is hardwired to thrive in its own environment. Nonetheless, they require a number…

Q: If we say that a certain STR locus has “high heterozygosity” in the human population, what do we…

A: Short tandem repeat (STR) markers or "core loci" are required for the entry of DNA genotype data…

Q: Consider the following sentence: "The dog did not eat." Which of the following variations of this…

A: Mutation is a random event. It is responsible for change the sequence of nucleotide in a gene.

Q: What are differences in which CMV & the ssRNA bacteriophages protect their genomes within the host…

A: To explain: To explain the differences in which cucumber mosaic virus and the ssRNA bacteriophages…

Q: Select the option that is a scientific hypothesis and is testable and false able?(Choose all that…

A: As per our company guideline we are supposed to answer only first question. Kindly repost other…

Q: Since different species of penguins may occupy the same habitat, explain why they may continue to…

A: Introduction Species include the members who are similar in morphology, and physiology and can…

Q: Compare and contrast GPCR and RTK signaling. What role does GTP play in each? What role does…

A: Receptors are composed of proteins. These involve in cell signaling process.Two types of receptors…

Q: Which of the following groups of early-diverging animals is comprised of two layers of cells that…

A: Introduction Divergent evolution:- It refers to the process by which interbreeding species diverged…

Q: Body organisation in Hydra is of- (A) Tissue grade (B) Organ grade (C) Cellular grade (D) Organ…

A: Introduction - Hydra is a phylum Cnidaria and class Hydrozoa genus of microscopic freshwater…

Q: Differentiate Kin selection from altruism.

A: View point of Kin Selection:- It believes that reproductive success is the main goal (for other…

Q: After reading the paragraph below, answer the questions that follow. You're the manager of a factory…

A: The activity of the enzymes is subject to many conditions and situations. Factors like temperature…

Q: Question 29 Gestalt theorists were interested in how we determine which part of the environment was…

A: Answer :: Gestalt psychology Gestalt Principles of Perceptual Organization Definition Gestalt…

Q: Question 9 What structural features are true regarding the transmembrane and cytoplasmic domains?…

A:

Q: ori Clo fcoR v OFP Below is the plasmid map of pGLO which contains the Green Fluorescent Protein…

A: pGLO:   pGLO is an engineered plasmid that contains genes for beta- Lactamase.  Beta-lactamase…

Q: you perform a cross of two heterozygous, red-eyed flies. They have 100 offspring. How many of these…

A:

Q: List and explain pre-analytical errors that can occur with a specimen and how these errors can…

A: Pre-analytical stages occur during patient preparation, sample collection, sample transportation,…

Q: DNA is composed of .which are attached to each other by bonds. O A) nucleotides. phosphodiester O B)…

A: DNA or Deoxyribonucleic acid is the genetic material in humans. It was discovered as a double helix…

Q: 15. Why is PK > PNa and by about how much?

A: After discovery of electricity, scientists discovered that conduction from brain to muscle was…

Q: AIDS evolves progressively. Identify the stages of the infection and describe the main symptoms of…

A: Human immunodeficiency virus causes the AIDS, which evolves in progressive manner.

Q: 15. Why is PK > PNa and by about how much?

A: Action potential   Action potential is a sudden change in the resting membrane potential of the…

Q: Cofactor/domain that moves between active sites in the PDH complex. O TPP O FAD O biotin O lipoamide…

A: The pyruvate dehydrogenase complex connects carbohydrates to the tricarboxylic acid cycle. Pyruvate…

Q: Why might high concentrations of urea unfold proteins?

A: The organic molecule urea, commonly known as carbamide, has the chemical formula CO(NH2)2. A…

Q: 160 140 120 100 80 60 40 20 1845 1865 1885 1905 1925 Time (years) (a) Based on the graph, identify…

A: The relationship between the lynx and the snowshoe hare is a classic example of the predator-prey…

Q: Why do some biologists think that the apicomplexans descended from dinoflagellates?

A: The finding of a nonphotosynthetic plastid in malaria and other apicomplexan pathogens has prompted…

Q: Olivia is a wilderness tour guide and spends her day hiking in the mountains. She uses 412 moles of…

A: As per question, Olivia uses 412 mol of ATP.  The source of ATPs to be considered are the fats…

Q: worm Disease Produced Infective stage Mode of Transmission Intermediate and definitive host enolepis…

A: Hymenolepis nana and dimunita are the species of tapeworm. H. dimunita has slightly bigger eggs and…

Q: Q4

A: The physiological lack which the sperm fulfills for an ovum is the lack of spindle set for…

Q: actice with Crosses. Show all work! 6. A homozygous round seeded plant is crossed with a homozygous…

A: The condition where two identical genes are present in an individual for a particular character, is…

Q: Why did Mendel self-pollinate the tall F1 plants to get the F2 generation and crossed a pure…

A: Introduction - The law of dominance, the law of segregation, and the law of independent assortment…

Q: Which one of the following is ordinarily not an air pollutant ? (A) CO2 (B) CO (C) SO2 (D)…

A: Air pollution is the contamination of air due to the presence of chemical, physical and biological…

Q: To explain: Why professional gardeners soak their seeds in hydrogen peroxide before planting.

A: Seeds inside each fruit are designed to germinate and grow into a new plant on their own, a process…

Q: 5) Snake venom surprisingly has been a found to be a rich source of biologically active peptides.…

A: Introduction - Snake venom is a very toxic saliva that contains zootoxins and is used to immobilise…

Q: Order Ca2+, CO2, ethanol, glucose, RNA, and H2Oaccording to their ability to diffuse through a lipid…

A: The lipid bilayer is composed of biological membranes and is composed of two layers of…

Q: The arteries that pass through the heart muscle are necessary for delivering enough oxygenated blood…

A: The pressure inside the vessels is generated by the blood volume. The pressure outside the vessel is…

Q: Stream invertebrates that break large pieces of allochthonous DOM into smaller pieces are referred…

A: Introduction Organic matter:- It is anything that contains carbon compounds that were formed by…

Q: A previously healthy female patient presents with fatigue and insomnia. An examination shows she is…

A: The above clinical presentation is a typical of a provisional diagnosis of Iron deficiency anemia.…

Q: 5. How might exposure to a more acidic pH affect the growth, development and reproduction of sea…

A: Sea urchins come under the category of keystone species, indicating their abundance has a direct…