One gene that affects three traits is an example of______ . a. dominance c. pleiotropy b. codominance d. epistasis

Q: What are the 4 mode types of disease? Explain each

A: Health is defined as the state of physical, mental and social well being. Disease refers to a condit...

Q: d. b. a. ok. C. h. List the names of the structures (A -L) and their primary functions

A: Answer  List the name of the structures (A-L) and their primary functions:

Q: Hello, good day. I have a problem answering this question, and I need your help. Hoping for a respon...

A: The hereditary material in humans and almost all other organisms is DNA or deoxyribonucleic acid. Th...

Q: Alzheimer's disease :the prevalence of the disease in the population. - include reference

A: Alzheimer's disease is most common in Western part of the Europe and least common in Africa. White p...

Q: Explain the mechanism of the arm abduction and adduction at the shoulder joint together with the res...

A: Abduction and Adduction are the movement of the arms of the body away or towards the body line. When...

Q: Question: Can two people have the same DNA?

A: *Humans will have 99.9% of DNA with each other. *So only 0.1% of  DNA is unique to all individuals. ...

Q: Which type of biome is found at the lowest latitudes? A. Rain forest В. Desert C. Chaparral D. Tundr...

A: 3. Option  A. Is correct Tropical rain forests are found in areas near the equator. Deserts, on the ...

Q: Which reaction normally happens in the regulation of the trp operon when high levels of tryptophan a...

A: The trp repressor controls the trp operon. When coupled to tryptophan, the trp repressor prevents th...

Q: Oxygen is required for the mitochondria to produce ATP. True

A:

Q: In the Hershey–Chase experiment, the radioactive label 32P was present inside bacterial cells (i.e.,...

A: DNA is an organic molecule that transmits information from generation to generation. Several experim...

Q: 3. Describe the effect of malaria on the frequency of the Hbs allele in areas where is common in are...

A: Sickle cell anaemia results in the single amino acid change in the beta chain of globin protein that...

Q: Phenotype to Population: 1. Describe how the phenotype of individuals with sickle cell disease influ...

A: Sickle cell anemia is an autosome linked (recessive) genetic disorder. 

Q: life history patterns and how different

A: Life history-A history of the changes through which an organism passes in its development from the p...

Q: Explain the Baroreceptor Reflex and how it regulates BP & HR. What are the receptors and neural path...

A: The baroreflex or baroreceptor reflex is a homeostatic mechanism in the body that contributes to the...

Q: Q8. Protein synthesis is carried out by the processes of transcription and translation. A short leng...

A: The transcription is the process by which RNA is produced from the DNA template and the translation ...

Q: Transmission of a nerve impulse across a gap between neurons is due to: a) Movement of a molecule, a...

A: Transmission of nerve impulse takes place jn brain as a result of stimuli. They are transmitted from...

Q: Explain the purpose of using powdered ammonium sulfate in the isolation of ovalbumin from egg whites...

A: Salting Out is a method of protein purification which utilizes the decreased solubility of a certain...

Q: If the code for an amino acid is ATG on the DNA molecules, this code on the transfer RNA molecule ma...

A: Note: As per Bartleby Guidelines For Remaining Answers Please Repost The Question. Introduction: DNA...

Q: h. Thomas Malthus economist who stated that hu- man populations grow faster than our resources i. ar...

A: Natural selection is a type of artificial selection, in this process organism adapt changes to becom...

Q: 4. Ensuring adequate maternal intake of a spe- cific nutrient is especially important in reduc- ing ...

A: C is the correct option.

Q: How does photosynthesis transform solar energy into the chemical energy of sugar molecules? Match th...

A: Photosynthesis is making energy-rich molecules like glucose, in the presence of green pigment Chloro...

Q: Did Soap Operas Reduce Fertility in Brazil?

A: In Brazil, there were no strict rules for a population control policy by the government, and it is i...

Q: II I III IV

A: Mannitol salt agar (MSA) The Mannitol Salt Agar (MSA) test is performed to see if the bacterium is h...

Q: A 42-year-old woman consults a dermatologist to evaluate and treat her glabellar lines (frown lines ...

A: The correct answer from the above option is option A.   

Q: What is DNA Replication? when can it happen? what are the steps in the process of DNA Replication? a...

A: Replication is the process by which DNA duplicate it's own strands . Replication of DNA is is divisi...

Q: Proteins can be separated into 9 general classifications based on the role they play in a cell. List...

A: Proteins can be classified into following types:- Fibrous Proteins Globular Proteins Derived Protei...

Q: Describe the way a Punnett square is used

A: Introduction :- The Punnett square is a square diagram used to forecast genotypes in a cross or bree...

Q: 5. Which correctly describes a process or event in the female repro- ductive cycle? A. The cycle is ...

A: The correct Answer is E

Q: What are the advantages and disadvantages of an endoskeleton?

A: The endoskeleton is the internal skeleton or cartilagenous structure of organisms (vertebrates) that...

Q: which cellular function is performed by only some types of cells?

A: Acording to question unique cells play which type of cellular function answer is brifly written in 2...

Q: Phenylethyl alcohol and why would it be useful in agar

A: Acoording to this question we have to decribe phenyl alcohol and the phenylethyl alcohol be useful i...

Q: 2. Describe how an individual's genotype influences their chance of contracting malaria: Which indiv...

A: Introduction :- Genotype is defined as the sum total of all the genes , specifying the phenotypes or...

Q: A marathon runner was disoriented and delirious post-race, and was found to have a serum [Na ] 128 m...

A: The correct option is C.

Q: This image is of the very back of the eye. Light would be coming in from the left towards the right ...

A: Eyes are organ that is responsible for vision. The eye ball is located inside in the bony orbit and ...

Q: Which of these is a tetrapod that is NOT an amniote?

A: Tetrapoda is a Greek term that means "four legs. The Tetrapoda includes amphibians, reptiles (includ...

Q: Dinosaurs like hardosaurs and others like duck bills if be hunter by predators what is their defense...

A: When a species goes extinct, it loses all of its genetic legacies. In order to adapt to environmenta...

Q: Below is a short segment of DNA molecule. transcribed the DNA codon into mRNA. TACCATGAGAATTGTGGTCAC...

A: Convertion of TACCATGAGAATTGTGGTCACCTTTTT ATGGTACTCTTAACACCAGTGGAAAAA to mRNA is done and results ar...

Q: 1) What makes the heart sounds? 2) Know the whole cycle/route that the blood takes from the heart th...

A: 1.Blood does not pass back from the atria into the great veins because the roots of great veins are ...

Q: Disorder of Sex Determination Now that you have reviewed typical sexual determination in humans, it ...

A: Swyer syndrome  It is an uncommon disorder that causes the sex glands (testicles or ovaries) to fai...

Q: Define the following terms: Bactericidal Bacteriostatic Antisepsis

A: Microorganisms are microscopic and most of them causes harmful effects in human body, but some of th...

Q: Do Gram-negative bacteria grow on PEA agar? If not, what prevents their growth?

A: ANSWER;-  

Q: There are base pairing rules for writing complimentary DNA strands for a given strand. A pairs with ...

A: According to Bartleby guidelines, we are supposed to answer first three subparts in case of multiple...

Q: 2. Distinguish among inducible, repressible, and constitutive gene operons.

A: An operon is a functional unit of genomic DNA that comprises a collection of genes that are all regu...

Q: laboratory

A: For testing a place equipped for experimental study in a science. Analysis a research laboratory bro...

Q: _____ are characteristic of cancer. a. Malignant cells b. Neoplasms c. Tumors

A: Introduction :- Cancer is a disease that occurs when cells divide uncontrollably and spread into nea...

Q: Many cancer cells are immortal and can be cultured in the laboratory for many years. Many of these c...

A: Introduction  The aging of cells can be attributed to several factors such as degradation of cellula...

Q: e coded information in a DNA molecule directly determines the formation of ____________. *   a. poly...

A: Since you have posted a question with multi- sub parts , we will solve first three sub-parts for you...

Q: Often reliquishing the young ones owing to food shortage is one of the common behaviour exhibited by...

A: Animal behaviour is the research of how animals navigate around in their surroundings, engage cooper...

Q: If agriculture on once-virgin tropical forest area were to stop, how would you speed-up the process ...

A: Secondary succession It refers to the ecological succession that takes place after the disruption of...

Q: If a person reaches a BAC of 0.060% and then stops drinking, we would estimate that all alcohol woul...

A: Introduction :- Blood alcohol levels are decided by the blood alcohol concentration calculator . It ...

Inheritance and Mendelian Genetics

Inheritance means the passing of traits to offspring from parents. These traits could be passed either through asexual reproduction or sexual reproduction. The offspring receives the genetic material from the parents. Mendelian inheritance is a certain biological inheritance that follows the rules and principles laid down by Gregor Mendel in 1865. The initial hypothesis was considered wrong, but other inheritance theories modified the concept of inheritance and thus genetics.