optons to all 3 drop down menus are:1. bottom strand2. right to left3. both right to left and left to right4. left to right5. top strand Use the following DNA sequence to answer the following questions5'-AGATTCCGGATATATATACCCAGGACC-3'3'-TCTAAGGCCTATATATATGGGTCCTGG-5If an origin of replication was contained within this sequence, in which direction would replication proceed?Choose...If instead replication initiated on the far right on this page, which direction would replication proceed throughthis sequence?Choose...(Cont. from Part 2) Would the leading strand of this incoming replication fork be on the top or the bottom ofthis diagram?Choose...

DNA replication is the process in which one DNA can form copies of it. The enzymes involved during…

Answered: optons to all 3 drop down menus are:…

optons to all 3 drop down menus are: 1. bottom strand 2. right to left 3. both right to left and left to right 4. left to right 5. top strand

Human Biology (MindTap Course List)

11th Edition

ISBN:9781305112100

Author:Cecie Starr, Beverly McMillan

Publisher:Cecie Starr, Beverly McMillan

Chapter21: Dna, Genes, And Biotechnology

Section: Chapter Questions

Problem 1RQ: Why is DNA replication called semiconservative?

See similar textbooks

Related questions

Q: Problem: 2m of DNA has to fit into a 6 micrometre nucleus

A: According to the question, we have to describe that how 2m of DNA has to fit into a 6 micrometer…

Q: Multiple Choice 1. Which is the correct amino acids using the anticodon strand of GCA-UCC-GCU? A.…

A: DNA stands for deoxyribonucleic acid whereas RNA stands for ribonucleic acid.

Q: uisCUntinuous 4. The sequence of base triplets on the coding strand of part DNA molecule is…

A: tRNA is a RNA molecule that helps in protein synthesis. tRNA forms base pair with complementary…

Q: hich repair mechanisms is most require to fix thymine dimers? BER NER mismatch repair…

A: When many proteins and RNAs are damaged, they will be degraded and sugars, are metabolized in order…

Q: In Figure 10-14, why does DNA migrate to the anode(+ pole)?

A: Deoxyribonucleic acid (DNA) is the double-stranded molecule that is the genetic material in most…

Q: Abands). Please, àdestity he 10. Samples were tested for sickle cell disease by PCR. The results…

A: HbA is the normal adult hemoglobin and HbS is the mutated one causing sickle-cell anemia. The…

Q: 2. Dr. Kim at Research Center performed shotgun Sanger sequencing on an unknown DNA sample, and…

A: In conventional sequencing method, in a reaction mixture, single-stranded molecules of the DNA,…

Q: 4.8. The figure below shows a snippet of DNA in the process of being replicated. The RNA primer is…

A: DNA replication is the process by which DNA makes a copy of itself during cell division. In order to…

Q: 6 of 11 The sequence shown below is the 5' to 3' strand of a dsDNA template. You are asked to design…

A: The PCR or polymerase chain reaction is a technique in which a particular DNA sequence is amplified…

Q: What enzyme that function for cutting a DNA?

A: Enzymes are proteins that help speed up chemical reactions in our bodies.

Q: G>

A: DNA stands for deoxyribonucleic acid. It is the genetic material in the cell.

Q: 9. Why does the lagging strand need Ligase? * O Polymerase runs 5' to 3'. This creates fragments and…

A: Replication is the process which is responsible for producing daughter DNA molecules from the…

Q: 5'- ATG CTG TTT GTA CGG GÁC TAA-3' a) Write out the DNA template side for the DNA coding side above?…

A: Introduction The term template strand refers to the sequence of DNA that is copied during the…

Q: Please ASAP. Thank you. What is the mechanism of action for CRE recombinase in the CRE-loxP system

A: Cre recombinase is tyrosine based enzyme and is derived from P1 bacteriophage. It uses topoisomerase…

Q: 5. Show the separation pattern of the following DNA molecules on an agarose gel electrophoresis. 5…

A: Forms of DNA gives different band pattern.

Q: Need question 6 answered

A: Agarose gel electrophoresis is the method in molecular biology, which is used to separate the DNA or…

Q: Why are the following reagents used? Neutralizing solution (Plasmid isolation) Isopropanol…

A: 1. DNA Neutralizing Solution can be utilised in separating of plasmid DNA by alkaline lysis…

Q: 6. Which of the following DNA sample composition is expected to have the highest boiling point? A.…

A: As per Chargaff's rule, number of guanine is equal to number of cytosine and amount of thymine is…

Q: True or False: When transcribing the missense strand the direction of growth is towards the…

A: "Genes" are the fundamental unit of heredity. They store genetic information in the form of DNA,…

Q: Name of Enzyme Function Helicase Topoisomerase DNA polymerase Ligase 7. Make a list of steps that…

A: The tightly packed genetic material located in the nucleus of a living organism which is made up of…

Q: Matching Type Choose the directionality of the given process. (4 points) What is the directionality…

A: Directionality is the property of being directional or maintaining a direction in general terms.…

Q: AKS 8a2, DOK 1) Based on the gel above, which bands traveled the slowest through the gel during the…

A: Question asked - which bands travelled the slowest? Band 1 because these are bigger pieces of DNA…

Q: Section Name MAPPING PRACTICE #4 Plasmid pBR 607 is a 2.6 Kb plasmid containing Ampicillin and…

A: Restriction enzymes are one of the important tools of recombinant DNA technology. The name…

Q: What are the answers to this

A: DNA replication is a process of producing another duplicate copy of the double strand DNA, where…

Q: Which is the correct pair of DNA with a strand of 3’-TTT-GGG-AAA-5’? A 5’-AAA-CCC-TTT-3’ B.…

A: DNA (Deoxyribose Nucleic acid is a double-stranded helical molecule that carries information for the…

Q: Some chromatin remodeling factors use energy from ATP hydrolysis to slide nucleosomes.shifting…

A: Chromatin remodeling can significantly alter gene expression. It is studied under the domain of…

Q: Need help on this biology homework question.

A: Gel electrophoresis is a technique based on the principle that it separates the DNA fragments based…

Q: Item humbers 15 to 19. Refer to the figure below. (answers are in letters only) B A. B b a. B B A. a…

A: The exchange of genetic material between non-sister chromatids of homologous chromosomes is known as…

Q: What enzyme proofreads the DNA molecule? Group of answer choices DNA gyrase DNA polymerase I DNA…

A: DNA replication is the process of synthesis of a new DNA molecule from a parent DNA by the enzyme…

Q: #2 under Process: Bases pair up quickly on the leading strand, however, the bases have to be filled…

A: Deoxyribonucleic acid (DNA) stores the cell’s genetic information and is present in the nucleus of…

Q: Bacteriophage T4 has a linear double-stranded DNA genome, yet mapping many mutations, as shown in…

A: T4 bacteriophage infects E.coli. It has a double stranded linear DNA genome. It undergoes a lytic…

Q: 3r 5' C ACAA AGGAAT Primer 5'-CUU-3' is being used to replicate this piece of DNA. What strand this…

A: DNA is a nucleic acid with deoxyribose sugar that is responsible for the inheritance of traits. The…

Q: nous bases are thymine. What percentage of cytosine nitrogen bases is present in this sample? a)…

A: DNA is made up of two complementary strands. Each strand is made up of nucleotides which is made up…

Q: DNA in an open configuration is common in the darkly staining regions called heterochromatin. True…

A: Deoxyribonucleic acid (DNA) is a polymer made up of two polynucleotide chains which wrap around…

Q: 8. What polypeptide sequence does the inserted gene code for? (Review protein synthesis and write…

A: The given question is based on the activity of the t rna that produces the protien by recognising…

Q: The line below depicts a DNA segment from a eukaryote. In this case, only the top, coding strand, is…

A: Eukaryotic DNA is enclosed within a double membrane bound nucleus. In eukaryotic transcription,…

Q: 5' ATTTACGTTTT 3' 3' TAAATGCAAAA 5' Need help drawing a diagram showing the replication…

A: DNA =Deoxyribose Nucleic Acid It is so named because there is no oxygen in the 2' end of ribose…

Q: 6. For each of the following tasks performed in the activity, describe what they are actually…

A: The process of gene transcription in order to generate RNA, the translation of RNA into proteins,…

Q: 1. In a DNA sample of Escherichia coli (a bacteria), 23.6% of the nitrogenous bases are thymine.…

A: A nucleotide of DNA contains a deoxyribose sugar molecule that attached to the phosphate group and a…

Q: Why does DNA replication only occur in the 5’ to 3’ direction? (A) 5' 3' (B) 5' 3' Should be PPP…

A: The central dogma of the cell is the process of the transfer of genetic material from DNA to…

Q: Ap Normal No Spacing Head 目三。、田 Paragraph Styles 1. You heve a circuler plasmid (pUC57), which…

A: We are allowed to do one or upto three subpart of a question. Please repost the undone question…

Q: JSmol Backbone Side groups Color Reset The first beta strand in primary sequence starts with residue…

A: Beta sheet is one of the motifs of secondary structure of protein. Each beta sheet is formed by beta…

Q: 7. Strand A represents one side of a DNA molecule, while Strand B represents a growing RNA molecule.…

A: Answer: Central dogma = This is the molecular process in the cell where DNA replicates called…

Q: The following nucleotide sequence is found on the template strand of DNA. First, determine the amino…

A: Amino acids are the amine groups consisting of carboxylic acids and a side chain which forms the…

Q: 24. Which of the following is a mismatch? Polymerase – Taq polymerase Template - double stranded DNA…

A: Since we have been instructed to answer only one question in a post, post other questions…

Q: True or False: 1. There is a reduction in the length of the DNA after every round of replication.…

A: The heterocatalytic process by which a new DNA strand is synthesized on a old DNA template is known…

Q: What are heterochromatin and euchromatin?

A: Introduction - Chromatin, which is made up of DNA and protein, is the substance that makes up a…

Q: 6. Which of the following DNA sample composition is expected to have the highest boiling point? A.…

A: Since you have asked multiple questions we will answer the first question for you. If you want any…

Q: Write down the DNA strand which is complementary to the strand shown below. Be sure to mark the ends…

Q: lasmid Mapping (what is it? why is it important?

A: Plasmid maps are graphical representation of plasmids, that show the locations of major identifiable…

Concept explainers

Genome annotation

The technique of linking biological information to genome sequences is termed genome annotation. Gene annotation is the method of identifying gene locations and coding sections. It helps us understand what these genes are doing in the body through establishing structural characteristics and linking them to the actions of various proteins.

Question

optons to all 3 drop down menus are:

1. bottom strand

2. right to left

3. both right to left and left to right

4. left to right

5. top strand

Use the following DNA sequence to answer the following questions
5'-AGATTCCGGATATATATACCCAGGACC-3'
3'-TCTAAGGCCTATATATATGGGTCCTGG-5
If an origin of replication was contained within this sequence, in which direction would replication proceed?
Choose...
If instead replication initiated on the far right on this page, which direction would replication proceed through
this sequence?
Choose...
(Cont. from Part 2) Would the leading strand of this incoming replication fork be on the top or the bottom of
this diagram?
Choose...

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

Suppose that replication is initiated in a medium containing moderately radioactive tritiated thymine. After a few minutes of incubation, the bacteria are transferred to a medium containing highly radioactive tritiated thymidine. Sketch the autoradiographic pattern that would be seen for (a) undirectional replication and (b) bidirectional replication, each from a single origin.
If the sequence 5′-AACGC-3′ were damaged by reactive oxygen species, what would be the most prevalent product, and what would be the result of replication? (Note: show both strands after replication)
Which statement below best describes what these data might have demonstrated to Kornberg about the process of replication? CHOOSE ONE and explain the rationale behind your answer in a minimum of four sentences. A. Products of replication are DNA polymers. B. DNA Pol I-mediated replication is a high-fidelity (i.e., no mistakes) process C. DNA Pol III-mediated replication gives rise to two daughter strands, one which is made of only the original templates, and one of which is only newly synthesized polymer. D. In DNA, all 4 classes of nitrogenous bases are more or less equally represented E. A pairs with T and C pairs with G
During DNA replication, the template sequence 5' ATAGGCC 3' would produce which one of the following sequences for the complementary strand? a. 5' GGCCTAT 3' b. 5' CCGGATA 3' c. 5' ATAGGCC 3' d. 5' TATCCGG 3'
The following DNA sequence is at the start of a DNA strand: 3'—AATTCGAGATTCA—5'. Which of the primer sequences below would be synthesized from this strand by DNA primase to initiate DNA replication? Group of answer choices a 3'—TTAACGTCTAAGT—5' b 3'—UUAAGCUCUAAGU—5' c 5'—TTAACGTCTAAGT—3' d 5'—UUAAGCUCUAAGU—3'
Why is the replication of DNA referred to as a semiconservative process? What is the experimental evidence for the semiconservative nature of the process? What experimental results would you expect if replication of DNA were a conservative process?
The sequence below shows the ends of one strand of a linear chromosome, with slashes representing the middle part, which is not shown. During replication of this one strand, on which side of the slashes will Okazaki fragments be made in the newly synthesized strand? 5' AGCCGTACGGTTATCTCCTAG //// GGGCCTATTGTGACCAGTGAGTCG 3' a) Both sides b) Neither side c) The right side d) The left side
The above experiment, on DNA synthesis in the intact chromosomes of E. coli (with no virus infection), demonstrates which of the following forms of DNA replication? completely discontinuous replication completely conservative replication completely dispersive replication semi-discontinuous replication semi-conservative replication
Why does DNA have a leading strand and a lagging strand during replication?Select the correct row below that fills in the following blanks to answer the question above.___1st___ has to attach the new free-floating nucleotides to the ___2nd___ of the newly formed strand. The two strands of a DNA molecule are antiparallel, so in order for the lagging strand to be formed in the same direction, it has to be done in Okazaki fragments going in a ___3rd___ direction. Select one: a. 1st 2nd 3rd DNA polymerase 3' end 5' to 3' b. 1st 2nd 3rd DNA polymerase 5' end 3' to 5' c. 1st 2nd 3rd DNA ligase 3' end 5' to 3' d. 1st 2nd 3rd DNA helicase 5' end 3' to 5'
Using 14N isotope medium for DNA replication instead of 15N, what would be observed ifDNA replication were conservative in one cycle of replication/in three cycles? How aboutdispersive replication in one cycle, in three cycles?
A circular molecule of DNA contains 1 million base pairs. If the rate of DNA synthesis at a replication fork is 100,000 nucleotides per minute, how much time will theta replication require to completely replicate the molecule, assuming that theta replication is bidirectional? How long will replication of this circular chromosome by rolling-circle replication take? Ignore replication of the displaced strand in rolling-circle replication.
In eukaryotes, the DNA replication rate is 50 nucleotides per second. How long would the replication of a chromosome of 150 million base pairs take if eukaryotic chromosomes were replicated like those of prokaryotes? Actually, eukaryotic replication takes only several hours. How do eukaryotes achieve this high rate?