Q4.8. The figure below shows a snippet of DNA in the process of being replicated. The RNA primer is shownas red while DNA is black. What will happen next? (Hint: Recall the order in which you used enzymes in theDNA replication simulation in Section 2.)3'-C GTAG ĂTC C G TA ČG C C TG CAUC UAGGCATGC G GA+3'3'Ligase will seal the nick in the bottom strand.DNA polymerase I will replace the primer with DNA.Helicase will separate the strands.DNA polymerase III will extend the primer.Submitin

Name: Q4.8. The figure below shows a snippet of DNA in the process of being
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: Q4.8. The figure below shows a snippet of DNA in the process of being replicated. The RNA primer is shownas red while DNA is black. What will happen next? (Hint: Recall the order in which you used enzymes in theDNA replication simulation in Section

DNA replication is the process by which DNA makes a copy of itself during cell division. In order to…

Science

Biology

4.8. The figure below shows a snippet of DNA in the process of being replicated. The RNA primer is shown red while DNA is black. What will happen next? (Hint: Recall the order in which you used enzymes in the NA replication simulation in Section 2.) 5 3- do ooo d GTAG ATC GCAUC UAGG CATG 2000Q -3' GGA 5' 3' Ligase will seal the nick in the bottom strand. DNA polymerase I ill replace the primer with DNA. Helicase will separate the strands. DNA polymerase IlIl will extend the primer. in

4.8. The figure below shows a snippet of DNA in the process of being replicated. The RNA primer is shown red while DNA is black. What will happen next? (Hint: Recall the order in which you used enzymes in the NA replication simulation in Section 2.) 5 3- do ooo d GTAG ATC GCAUC UAGG CATG 2000Q -3' GGA 5' 3' Ligase will seal the nick in the bottom strand. DNA polymerase I ill replace the primer with DNA. Helicase will separate the strands. DNA polymerase IlIl will extend the primer. in

Biology 2e

2nd Edition

ISBN:9781947172517

Author:Matthew Douglas, Jung Choi, Mary Ann Clark

Publisher:Matthew Douglas, Jung Choi, Mary Ann Clark

Chapter14: Dna Structure And Function

Section: Chapter Questions

Problem 17RQ: Which of the following is not a true statement comparing prokaryotic and eukaryotic DNA replication?...

See similar textbooks

Similar questions

18. If 32P is used to label both strands of double-stranded DNA, after two rounds of replication, four double-stranded molecules of DNA are produced. Of these,a. one of the four double-stranded molecules of DNA will contain all the 32Pb. two of the four double-stranded molecules of DNA will contain 32P, each with half of the 32Pc. three of the four double-stranded molecules of DNA will contain 32P, each with 1/3 of the 32Pd. all four double-stranded molecules of DNA will contain 32P, each with ¼ of the 32Pe. none of the double-stranded molecules of DNA will contain 32P
1c) Briefly explain how the product molecules of rolling circle replication differs from the products of conservative, semi-conservative, or dispersive replication.
4. During DNA replication, one of the new strands of DNA is synthesized continuously, while the other is synthesized as a number of separate fragments of DNA that are subsequently linked. Why does this occur? Option 1a) replication starts at many points on the chromosomeOption 2b) replication can only start at one place on each strand of DNAOption 3c) RNA primers only anneal to one of the parental strands of DNAOption 4d) DNA polymerase III only synthesizes DNA in the 3' - 5' directionOption 5e) DNA polymerase III only synthesizes DNA in the 5' - 3' direction A piece of double-stranded DNA consists of 18 nucleotides. How many codons would the first-formed mRNA transcript have? Option 1a) 18 CodonsOption 2b) 9 CodonsOption 3c) 6 CodonsOption 4d) 3 Codons
1c) During DNA replication, both positive and negative supercoiling is introduced in the DNA being replicated. Name the enzymes that introduce supercoiling into DNA during replication; please clearly indicate which enzyme(s) introduce positive supercoiling and which enzyme(s) introduce negative supercoiling.
Imagine the Meselson and Stahl experiments had supported conservative replication instead of semiconservative replication. What results would you predict to observe after two rounds of replication? Be specific regarding percent distributions of DNA incorporating 15N and 14N in the gradient.
Which of the following statements about DNA replication is false? a. Synthesis of the new DNA strand is from 39 to 59. b. Synthesis of the new DNA strand is from 59 to 39. c. DNA unwinds, primase adds RNA primer, and DNApolymerases synthesize the new strand and remove the RNAprimer. d. Many initiation points exist in each eukaryotic chromosome. e. Okazaki fragments are synthesized in the opposite directionfrom the direction in which the replication fork moves.
In the Hershey-Chase experiment with bacteriophages, (a) harmless bacterial cells permanently transformed into virulent cells (b) DNA was shown to be the transforming factor of earlier bacterial transformation experiments (c) the replication of DNA was conclusively shown to be semiconservative (d) viral DNA was shown to enter bacterial cells and cause the production of new viruses within the bacteria (e) viruses injected their proteins, not their DNA, into bacterial cells
22. A portion of one strand of DNA has the sequence 5′ ATTCGGTAA 3′. If this strand is used as a template for DNA replication, which of the following correctly depicts the sequence of the newly synthesized strand in the direction in which it will be synthesized? Group of answer choices 1. 5' TTACCGAAT 3' 2. 3′ TTACCGAAT 5′ 3. 5′ TAAGCCATT 3′ 4. 3′ AATGGCTTA 5′
21. The difference between a nucleoside and nucleotide is: Group of answer choices 1. A nucleoside consists of the sugar with a nitrogenous base, whereas a nucleotide has a sugar with a nitrogenous base and phosphate groups attached to the sugar. 2. Nucleotides contain deoxyribose sugar and nucleosides contain ribose sugar 3. Nucleotides are involved in eukaryotic DNA replication, while nucleosides are used in bacterial DNA replication 4. A nucleotide consists of the sugar with a nitrogenous base, whereas a nucleoside has a sugar with a nitrogenous base and phosphate groups attached to the sugar.
3. Using the same template strand, transcribe the DNA:GCA TAG CAA TGC
2. List the DNA strand sequence complementary to the template strand. CCUGCAGUAUGAAACGCCUGGUAGAAGGUGGGAAGUGGUGCGCCC . . .
10. Taq polymerase, a DNA polymerase derived from thermophilic bacteria, is used in polymerase chain reactions (PCR) in the laboratory. During PCR, Taq catalyzes DNA polymerization, similar to how it would in bacteria. A normal PCR cycle is as follows:1. Melting/Denaturing 95°C2. Primer Annealing 50°C3. Elongation of DNA (repeat 20–30 cycles) 72°C Which of the following conditions likely describes the living environment of Taq bacteria?(A) Freshwater with acidic pH(B) Hydrothermal vents reaching temperatures between 70– 75°C(C) Hot springs of 40°C(D) Tide pools with high salinity