Order the following technical steps that are required to identify a bacterium by PCR and sequencing of the 16S rRNA gene. [1 mark] - Carry out thermal cycling (amplification) of the PCR - Checking the PCR product (amplication) by agarose gel electrophoresis - Purify the PCR product - Perform a DNA extraction - Sequence the PCR product(Sanger sequencing) - Grow a fresh overnigh liquid culture - Obtain a pure bacterial culture - Set up a 16S Rrna gene PCR - Perform bioinformatic analysis (BLAST)

Order the following technical steps that are required to identify a bacterium by PCR and sequencing of the 16S rRNA gene. [1 mark] - Carry out thermal cycling (amplification) of the PCR - Checking the PCR product (amplication) by agarose gel electrophoresis - Purify the PCR product - Perform a DNA extraction - Sequence the PCR product(Sanger sequencing) - Grow a fresh overnigh liquid culture - Obtain a pure bacterial culture - Set up a 16S Rrna gene PCR - Perform bioinformatic analysis (BLAST)

Biology Today and Tomorrow without Physiology (MindTap Course List)

5th Edition

ISBN:9781305117396

Author:Cecie Starr, Christine Evers, Lisa Starr

Publisher:Cecie Starr, Christine Evers, Lisa Starr

Chapter10: Biotechnology

Section: Chapter Questions

Problem 10SQ

See similar textbooks

Similar questions

A urine sample has been obtained, and the bacteria in this sample were cultured. To obtain more information regarding the identity of this Gram-negative strain, Sanger sequencing can be used. A bacterial colony is transferred into a 0.2 mL tube containing buffer, then boiled to break open the bacterial cells. The tube is centrifuged, and some of the supernatant is transferred to a PCR tube. Next, the following reagents are added: DNA polymerase, a primer that binds near the 16S rRNA region of the bacterial chromosome, dNTPs, and fluorescently-labeled ddNTPs. The sequencing reaction is processed in a thermocycler, then analyzed by capillary electrophoresis. This experiment generates the following results (in FASTA format): > sequencing results TAACAGGAAGCAGCTTGCTGCTTTGCTGACGAGTGGCGGACGGGTGAGTAATG TCTGGGAAACTGCCTGATGGAGGGGGATAACTACTGGAAACGGTAGCTAATAC CGCATAACGTCGCAAGCACAAAGAGGGGGACCTTAGGGCCTCTTGCCATCGGA TGTGCCCAGATGGGATTAGCTAGTAGGTGGGGTAACGGCTCACCTAGGCGACG…
Place the stages of PCR in the correct order -Anneal-Denature-Analyse-Extend
Which of the following ARE part of a typical PCR reaction mixture? DNA ligase dNTPs (mix of nucleoside tri-phosphates) RNA primers made by primase enzyme template DNA, often from cells collected from hair, cheek swab, or blood 2 DNA primers polymerase enzyme
Which is a complete list of the ingredients that are essential for PCR? nucleotides, DNA template, Taq polymerase, and plasmids nucleotides, DNA template, DNA ligase, and plasmids nucleotides, DNA template, Taq polymerase, and primers restriction enzymes, DNA template, Taq polymerase, and primers nucleotides, DNA template, DNA ligase, and primers
Identify three items (aside from water) that must be used in a Polymerase Chain Reaction (PCR) mixture.
What molecular biology technique is used to amplify DNA from an evidence sample? Reverse dot blotting Southern hybridization Cloning Polymerase chain reaction (PCR) Capillary electrophoresis
Identify if the following statements are true or false. Quantitative PCR is also known as the real-time PCR Real-time PCR method uses fluorescent dyes such as acridine orange
a. DNA fingerprinting is a method of visualizing similarities and differences in the DNA sequence of individuals. Arrange the following items so that they show the DNA fingerprinting steps in proper order: - Gel electrophoresis - Stain or probe for DNA - cut DNA into fragments - Amplify DNA sample using PCR b. On the gel shown below are four DNA samples. Samples A to C are taken from tissues of landslide victims that are being identified, while sample D came from a hair sample brought by a mother looking for the remains of her son. (see img) i. If similar band patterns in a gel are created using the same restriction enzyme, what does that tell you about the DNA sequence of the samples? ii. In sample C, only two fragments were created. How many restriction sites (regions where enzymes cut) are present in sample C?
The laboratory has lost the protocol to follow during the PCR reaction and only give you this. Please fill in the blanks: 94°C _______________ step for _______ minutes 52°C _______________ step for _______ seconds 72°C________________ step for ______ minutes 72°C _______________ step for ______ minutes
Why different temperatures are used in a PCR reaction? Please answer at your own words.
A thermocycler is a machine used to heat and cool the PCR sample in a series of three steps per cycle. Describe briefly what happens in each step. a. Step 1 - Heat briefly (for 1 min) to 94 degrees Celsius to ___________ b. Step 2 - Cool (for 1 min) to 50 degrees Celsius to _____________ c. Step 3 - Heat (for 1 min) to 72 degrees Celsius to _____________
Recently, I am designing primers specific for Lactobacillus sp. (partial sequence of the 16s rRNA gene) and can get successful amplification on my conventional PCR. Then I am going to quantify by RT-PCR using SyBr Green Reagent in Step One Plus Instrument. By using the same run condition as the conventional PCR, I face the problem that many of my samples got a bad melting curve. Anyone have the same experience as me or suggestion please let me know. Thanks in advance.