Mutation #3 DNA template: 3' TA CGCGCTGCACGATGCAGTAGTACATC 5' mRNA transcript sequence: Amino acid sequence: Type of mutation: Mutation #4 DNA template: 3' TACGCGTGCACGATGCAGTAATACATC5' mRNA transcript sequence: Amino acid sequence: Type of mutation:
Q: What species of plasmodium causes the worst malaria infections
A: Several factors contribute to the 'severity' of malaria caused by certain 'Plasmodium' species.…
Q: why are cyberattacks in healthcare a challenging issue for healthcare administrators
A: The objective of the question is to understand why cyberattacks pose a significant challenge for…
Q: If a DNA molecule of 50 base pairs contains 15 cytosine bases (C), how many thymine bases will it…
A: The objective of the question is to find out the number of thymine bases in a DNA molecule given the…
Q: Hemophilia is a recessive sex-linked disorder (Xh). A man with hemophilia and a female carrier are…
A: Alleles are the alternative forms of a gene that are located on the same locus of a homologous…
Q: 1. How do we measure and define evolution? 2. Evolution occurs: 1. at the level of the individual.…
A: Understanding evolutionary biology involves exploring the mechanisms driving the diversity of life…
Q: Following a fracture of the humerus, an adult patient has a biopsy of the healing area. Which of the…
A: The question is asking about the type of bone that is most likely to be seen in a biopsy of a…
Q: to produce four aughter cells. If a nondisjunction of an autosome happens during meiosis I, what are…
A: Meiosis : In this type of cell division a parent cell is divided into four genetically different…
Q: Classify the given items with the appropriate group. Neuron is hyperpolarized Occurs when…
A: Relative Refractory PeriodNeuron is hyperpolarized: This occurs during the Relative Refractory…
Q: Which of the following is an example of virus-encoded molecules modifying signal transduction…
A: The objective of the question is to identify which of the given options is an example of…
Q: Explain the difference between generalized and specialized characteristics. What are examples of…
A: Generalized and specialized characteristics refer to two contrasting strategies that organisms…
Q: Mallard duck production characteristics
A: Mallard duck production involves breeding, incubating eggs, hatching, and brooding. Ducklings…
Q: Please associate the explanation with the correct de-extinction methods, some of which are still…
A: The objective of the question is to match the given de-extinction methods with their correct…
Q: Observation of a hematoxylin and eosin- stained microscope slide reveals that the nuclei are blue.…
A: The objective of the question is to understand the reason behind the blue color of nuclei in a…
Q: Two cultures of a facultative anaerobe are grown in the same medium, but one culture is exposed to…
A: Facultative anaerobes can live with or without oxygen. They prefer to live in aerobic condition, but…
Q: What do scurvy, brittle bone disease, and the hyperextensibility syndrome have in common?
A: Scurvy, brittle bone malady (osteogenesis imperfecta), and hyperextensibility syndrome (regularly…
Q: What are the three major steps of phylogenetic reconstruction using the parsimony method? Find the…
A: Step 1: Sequence alignment: Aligning the sequences to identify shared characteristics.Step2: Find…
Q: Does RNA have polarity?
A: In molecular biology, the structure and function of nucleic acids are foundational for understanding…
Q: Explain the research methodology, design, and analyses.
A: The research methodology of this study involved analyzing metadata from a large set of peer-reviewed…
Q: Both bison reintroduced to Banff National Park and burrowing owl reinforcement in BC used soft…
A: The question is asking whether both the bison reintroduced to Banff National Park and the burrowing…
Q: Diagram or describe the replication cycle of HIV-1. Indicate all the steps/stages that can NOT be…
A: The replication cycle of HIV-1 (Human Immunodeficiency Virus type 1) is a complex process that HIV,…
Q: Based on base substitution rates, which of the following is likely to be true? P(A/G) + P(A/T)…
A: In molecular biology, base substitution mutations are classified into two main…
Q: Describe how tRNA is charged with an amino acid.
A: Transfer ribonucleic acid (tRNA) is a kind of RNA molecule that unravels a courier RNA (mRNA)…
Q: What is the difference between primary succession and secondary succession?…
A: The objective of the question is to understand the difference between primary succession and…
Q: A nucleoside consists of a pentose sugar linked to a nitrogenous base and a phosphate group True…
A: There are four types of nitrogenous bases found in DNA, adenine (A), thymine (T), cytosine (C) and…
Q: Assume a deletion occurs in a gene that encodes DNA polymerase I and no functional DNA polymerase I…
A: The objective of the question is to understand the role of DNA polymerase I in DNA replication and…
Q: 700 600 500 400 300 200 100 30 10 ||| MW III-1 III-2 IV-1 E1 E2 E3 E4 E5 E6 MW= molecular weight…
A: Inheritance of genetic disease could be as follows,Autosomal dominant(if a single parent is…
Q: Select all that apply. Beetles from two geographically isolated populations are captured and brought…
A: If two organisms (of different sex) are capable of reproducing (in the case of sexual reproduction)…
Q: Formulate a short introduction that emphasises the importance of understanding the structure and…
A: By promoting the efflux of alanine, an important amino acid required for several cellular functions,…
Q: The connective tissue is a Tissue that supports, protects, and gives structure to other tissues and…
A: The tissues which are derived from embryonic mesoderm, present throughout the body to support and…
Q: Which of the following cells share a common progenitor cell with macrophages? a)Astrocytes b)…
A: The question is asking us to identify which of the listed cell types shares a common progenitor cell…
Q: Which of the following is NOT true for the speciation of finches in the Galapagos islands? A.…
A: Analyzing Statements about the Speciation of Galapagos Finches:The statement that is NOT true about…
Q: Last word is anterior
A: One could make transgenic flies that contain a series of deletions spanning ALL SEGMENTS of the…
Q: 24-year-old delivery driver is involved in an accident and sustains a wide abrasion over his left…
A: The objective of the question is to identify the mechanism that allows for the restoration of the…
Q: Which of the below pedigrees best depicts the inheritance pattern of sickle cell anemia? Explain…
A: Sickle cell anemia-It is an autosomal recessive disorder. If both alleles are mutant, then it would…
Q: Tropism refers to the spectrum of tissues infected by a virus. Which parameter can influence viral…
A: The objective of the question is to identify the factors that can influence viral tropism, which is…
Q: NE The black line drawn across this photomicrograph of a seminiferous tubule represents the line of…
A: The question is asking us to identify the line of demarcation in a seminiferous tubule, which is a…
Q: A pathologist uses monoclonal antibodies against several intermediate filament proteins and finds…
A: The objective of the question is to identify the tissue of origin of a tumor based on the presence…
Q: After some time, you found out that you did not like working in microbiology lab, so you found a job…
A: Upon analyzing the park pond water and considering the dogs' illnesses, it's plausible that harmful…
Q: A particular deer population has 50 M individuals, 30 MN individuals, and 70 N individuals. What are…
A: The Hardy-Weinberg law states that the allele and genotypic frequencies in a large, randomly mating…
Q: Which of the following sites contains striated muscle that is not under voluntary control? A.…
A: A soft tissue that found in both animals and humans is called muscle. It is made up of actim and…
Q: For Each of your 3 DNA Templates, Fill out the Following: DNA Template # DNA sequence (copy from the…
A: The process of gene expression involves transcribing DNA into mRNA and then translating mRNA into an…
Q: Suppose part of the amino acid sequence of a protein is N... Gly-Ala - Pro-Arg-Lys ...C. Which of…
A: A frameshift mutation occurs when nucleotides are inserted or deleted from the DNA sequence, causing…
Q: Rose plants are octoploid (octo = 8). Gametes from a rose plant contain 40 chromosomes. Indicate…
A: The correct statements are:The number of chromatids in a rose plant cell at G2 of the cell cycle is…
Q: Exponential population growth occurs when N=K. True False
A: The statement in question is referring to the concept of population growth in biology, specifically…
Q: for the following amino acids below circle the r groups then tell me if they are polar or nonpolar
A: Contain polar side chains.Interact well with water due to the presence of polar groups like hydroxyl…
Q: A gypsy moth population has overtaken a grove of oak trees. The gypsy moths eat the trees, causing…
A: The objective of the question is to identify the type of density-dependent factor that the gypsy…
Q: What is an anticodon and where is it located on the tRNA structure?
A: The anticodon is a distinctive three-nucleotide sequence present on transfer RNA (t RNA) molecules.…
Q: ry A Detail the process of an adaptive immune response, highlighting the key steps involved in the…
A: The immune system produces two primary responses: the immune system's adaptive response, that's is…
Q: Some geneticists, notably Nobel Prize-winner Dr. Herman J. Muller, have proposed that sperm banks…
A: The concept of using sperm banks to choose sperm cells from givers with uncommon qualities like…
Q: Alpha 2 adrenergic receptors play a key role in endogenous pain control circuits and are…
A: The question is asking about the characteristics of alpha 2 adrenergic receptors, which are a type…
Trending now
This is a popular solution!
Step by step
Solved in 1 steps
- Silent Mutations in DNA – Notice one nucleotide pair differs from the normal sequence given in question #6. 5’ ATG GGA GAT TAT TAG 3’ (non-template strand) 3’ TAC CCT CTA ATA ATC 5’ (template strand) What would be the mRNA sequence when this mutated DNA is transcribed? What would be the resulting amino acid sequence when your answer to 7a is translated?1. (a)How many amino acids are found in the polypeptide when the mRNA is translated? mRNA 5 - AAUAUGCGGAUGCCCGAA -3 4 5 6 7 (b) "In this mutation, the UGG codon is replaced with UGA." missense mutation nonsense mutation silent mutation frameshift mutationMutated DNA Sequence #2: T A C G A C C T T G G C G A C G A C T What’s the mRNA sequence? (Circle the change) What will be the amino acid sequence? Will there likely be effects? What kind of mutation is this?
- 1. (a) "In this mutation, most amino acids are replaced due to a deletion of a nucleotide base." missense mutation nonsense mutation silent mutation frameshift mutation (b) How many codons are found in the mRNA below?mRNA 5 - AAUAUGCGGAUGCCCGAA -3 4 5 6 7Mutated DNA Sequence #2 T A C G A C C T T G G C G A C G A C T … What’s the mRNA sequence? (Circle the change) What will be the amino acid sequence? Will there likely be effects? What type of mutation is this? ________________________________Mutated DNA Sequence #2: T A C G A C C T T G G C G A C G A C TWhat’s the mRNA sequence?What will be the amino acid sequence?What kind of mutation is this?Will there likely be effects?
- Mutated DNA Sequence #1 T A C A T C T T G G C G A C G A C T … What’s the mRNA sequence? (Circle the change) What will be the amino acid sequence? Will there likely be effects? What type of mutation is this?1. (a)What mutation would result to a change of AUG codon to AGG? missense mutation nonsense mutation silent mutation frameshift mutation (b) Which mutation that would result to a change of amino acid in the polypeptide? missense mutation nonsense mutation silent mutation frameshift mutationDNA: 3’ TACAGTCTGTAGCGTACATTATCGTGACCGACT 5’ From the given DNA sequence above, change one base in codon 6 to show nonsense mutation.Rewrite the resulting DNA sequence below and encircle the base that you changed.DNA:mRNA:polypeptide chain:
- 1. (a) Which codon is the start codon in the mRNA below? mRNA 5 - AAUAUGCGGAUGCCCGAA -3 AAU UUA AUG UAG (b) There is an addition of Adenine in the mRNA sequence specifically at AUG codon. missense mutation nonsense mutation silent mutation frameshift mutationTranscription. Using strand 1 of the DNA molecule as a template, transcribe a messenger RNA molecule (a.k.a. mRNA transcript). Strand 1 3’ End TTG CTT CAC CTT GCG CGC CCG CGC TAA TTG 5’ end mRNADNA, RNA, AND PROTEIN SYNTHESIS (FILL IN THE BLANKS) GIVEN THE FOLLOWING CODING SEQUENCE FOR DNA, PROVIDE THE SEQUENCE OF THE COMPLEMENTARY(TEMPLATE) SEQUENCE. CODING SEQUENCE/ 5' ATGCATAGATTAGGATATCCCAGATAG 3' COMPLEMENTARY SEQUENCE: 3' ______________________________ 5' CODING SEQUENCE ~ mRNA transcript: 5' _______________________ 3' TRANSLATE THE GIVEN mRNA TRANSCRIPT INTO A POLYPEPTIDE SEQUENCE (REFER TO THE GENETIC CODE) POLYPEPTIDE SEQUENCE: _________________________________