5' carbon = 3' carbon =hydrogen bond =phosphodiester bond =phosphate group =deoxyribose sugar =nitrogenous base = OM₂NTodNH NP=0HOP=ONH₂O"N **** HN•H₂NDF01PIOHGO=P OHH₂NHPORK-OHOn the diagram of a DNA molecule above, select the letter that labels theeach component listed below.

DNA: DNA (deoxyribonucleic acid) is a molecule that contains the genetic instructions used in the…

Answered: P=0 HO-P=O N³H!.... NH N NH₂O 'N *****…

Science

Biology

P=0 HO-P=O N³H!.... NH N NH₂O 'N ***** HN N= E 01PIOH G 01PIOH H₂N H -OH

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter8: The Structure, Replication, And Chromosomal Organization Of Dna

Section: Chapter Questions

Problem 12QP: DNA contains many hydrogen bonds. Are hydrogen bonds stronger or weaker than covalent bonds? What...

See similar textbooks

Related questions

Q: The diploid that resulted from mating these two haploids would have which of the following…

A: Auxotrophs are microorganism strains that are unable to synthesise an essential nutrient required…

Q: 4. A population of 13000 individuals is subdivided in three subpopulations as shown in the table…

A: The association of alleles at two or more loci on a chromosome that is not random is referred to as…

Q: An in-class test of the opponent process theory of color vision relied on a basic principle of…

A: Color vision theory is a scientific explanation for how the human eye and brain perceive and process…

Q: True and False 1. Hyaluronate is a glycoprotein 2. I-cell disease results from enzymes being…

A: 1. Hyaluronate is a glycoprotein (false) Explanation:- Hyaluronate is not a glycoprotein. It is a…

Q: Clinical trials to prevent activation and invasion of cancer metastasis, explain where they are in…

A: Clinical trials to prevent cancer metastasis are ongoing and showing promising results. Metastasis…

Q: Psilocybin is rapidly de-phosphorylated in the body into psilocin, which is anagonist For the 5-HT…

A: The topic of this question involves the molecular structure of the 5-HT 2A receptor and its…

Q: What are the mechanisms of glycosylation within the cell? What is the purpose of glycosylation of…

A: Glycosylation is an enzymatic process that attaches sugar molecules (also known as glycans) to…

Q: Determine whether each event occurs during initiation, elongation, or termination. Initiation…

A: During translation, ribosomes move along the mRNA strand, reading the genetic code and using it to…

Q: 1. Character: Eggplant Color Trait: V = violet color v=green color V Vv Vv V VV VV 2. Character:…

A: It was given that monohybrid cross for the eggplant color trait: * One parent is heterozygous violet…

Q: THIS IS A MULTIPART QUESTION, PLEASE ANSWER ALL Using the image: 1. How would you categorize this…

A: Understanding microbe dietary needs is essential for investigating their physiology and behavior. A…

Q: Would you expect DCPIP to become colorless if your chloroplast suspension is in the presence of the…

A: Introduction Chloroplasts are organelles found in plant and algal cells that are responsible for…

Q: Illustrate a SARS-CoV-2 virion. Label the ssRNA and the 4 structural proteins. Indicate (write) the…

A: Severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) has rapidly spread in humans in almost…

Q: Label the molecules in this figure showing how IP3 and DAG function as second messengers. Note: not…

A: Small molecules such as ions or proteins capable of transmitting signals to target molecules via…

Q: Dicsussion of the effect of dehyrogenase in the color intensity of metylene blue with fresh mungbean…

A: Dehydrogenase is a type of enzyme that catalyzes the removal of hydrogen atoms from a substrate,…

Q: What is shown in the graph? A) B) C) D) 40,000 Population 0 exponential decay of a population…

A: INTRODUCTION Exponential growth Type of growth in which quantity increses by the same percent in…

Q: How do stem cell (mouse embryonic cell) moving under microscope? What are the behaviors of the…

A: Mouse embryonic stem cells are derived from the inner mass of cells of embryo. These cells can be…

Q: Draw the distribution of DNA (one set of homologous chromosomes) during meiosis. What happens in…

A: Meiosis is a type of reductional cell division in sex-cell such as gametes which results in the…

Q: Please help me with the following question and make sure its 100% accurate pls Can parents…

A: Porter and Moore (1981) conducted an investigation by giving new T-shirts to the children of nine…

Q: Modifications of histone tails to gain access to a gene is known as ______. Chromatin…

A: Introduction :- Chromatin is the complex of DNA and proteins that make up the chromosomes within the…

Q: Chapter 7 ● What types of nutrients do microbes require, and where are they obtained? What are the…

A: As per bartleby honour code ony 3 questions can be answered. Please post remaining questions…

Q: How do psychedelic drugs differ in their psychological/subjective effects?

A: Psychedelic drugs are a class of psychoactive substances that produce profound alterations in…

Q: Inflammation is often spoken of as something to be avoided. However, inflammation is really part of…

A: Answer : Q1. Acute inflammation Chronic inflammation It has a rapid onset. It has late or…

Q: If you wanted to use the molecular clock to estimate times of divergence for phylogenetically…

A: Introduction: A gene is a segment of DNA that contains the instructions for the development,…

Q: propose improvement to a device that harness energy from moving water and inspiration is taken from…

A: Biomimicry is a method of problem solving and creating long-term solutions that draws inspiration…

Q: Give typing answer to all parts with explanation and conclusion (i) what the Biopharmacutics…

A: Drugs are substances that can have physiological effects when introduced into the body. They can be…

Q: a. Provide correct annotation for the results of Tube C in the KIA test pictured below. A B C D b.…

A: Microbes are microscopic organism that cannot seen as such through naked eyes but require microscope…

Q: Biological evolution is best defined as A. the process of direct observation B. unchanging nature of…

A: Biological Evolution: Biological evolution refers to the process by which species of organisms…

Q: 9. In relating the form to its function, which of the following correctly explains why spongy bone…

A: Spongy bone, also known as cancellous or trabecular bone, is a type of bone tissue that is lighter…

Q: ● ● ● What is metabolism, and what are the two general types of metabolic reactions? Enzymes: What…

A: A metabolic pathway is a network of interconnected biochemical reactions that take place within a…

Q: In humans, normal skin color (A) is dominant over albino (a). An albino man marries a normal woman…

A: Alleles are passed down to the organism's progeny. They come in two varieties: dominant alleles and…

Q: n the article the “Overall, the composition of the cores and insides of the Gouda cheeses were more…

A: Gouda cheese is a semi-hard cheese that originated in the Netherlands. It is named after the city of…

Q: When oxygen is unavailable, some cells use anaerobic (fermentation) pathways to make ATP. Another…

A: Anaerobic Respiration: Anaerobic respiration is a metabolic process that occurs in the absence of…

Q: 0 What is phenotypic plasticity? O When a phenotype is exaggerated in males. O When a phenotype is…

A: Introduction:- Phenotypic refers to the observable characteristics or traits of an organism that…

Q: Fill in the blanks below using the correct molecule from above: A I am organic…

A: Introduction : Biomolecules are the essential organic molecules, which are involved in the…

Q: Describe the physical, chemical and biological limitations for those available microhabitats. Relate…

A: Ecology is the scientific study of the relationships between living organisms and their environment.…

Q: 5. A new organism is discovered in the forests of Costa Rica. Scientists there determine that the…

A: Introduction: The blueprint for all living things is a complicated molecule called DNA…

Q: Based on the alignment of these protein sequences below, which [pairs] of the genes appear to be…

A: Based on the alignment of the protein sequences provided in the image, it appears that: SEQUENCE 2…

Q: Choose the 4 most correct steps from the list below for a simple positive stain and organize them…

A: The above question is related to the laboratory technique of bacterial staining. Staining is a…

Q: Problem 3: Proteins that bend DNA Integration Host Factor, IHF, is an architectural protein in E.…

A: 1A) The following formula can be used to calculate the bending coefficient of DNA: k = (E x I) / L3…

Q: SEARCH INFORMATION ABOUT ADDISON AND CROHN DISEASE IN ANIMALS: 2. YOU MUST EXPLAIN A LITTLE ABOUT…

A: Addison's disease, also known as hypoadrenocorticism, is a rare condition in which the adrenal…

Q: Part A The bacterial gene little protein (lilP) makes a small protein of 11 animo acids (AA) in…

A: Transcription is the first step of gene expression where the enzyme RNA polymerase is uses DNA as a…

Q: For those who aren't scientists, there is disappointment when it's learned that scientists don't…

A: The evolution and diversification of angiosperms, or flowering plants, has been a subject of…

Q: 6. Mathematically show how you would find the number of gametes possible from an individual with the…

A: Introduction Gametes are reproductive cells that are produced by organisms that reproduce sexually.…

Q: What are some of the best foods to eat for digestive health?

A: There are several foods that can support digestive health and promote a healthy gut microbiome. Here…

Q: Breast cancer is one of the most common cancers among women. The exact cause of breast cancer is…

A: Breast cancer is a disease characterized by the abnormal growth of cells in the breast tissue.…

Q: From the above sequence I have copied the first 500bp of the sequence into Word.…

A: PCR and molecular cloning are important techniques used in molecular biology to amplify and…

Q: What kind of mutation in intron 1 could lead to this? Explain how this mutation would lead to a…

A: We have been told to answer the question in less than 100 words. We have to explain which type of…

Q: How is a phylogenetic bootstrap value calculated?

A: The phylogenetic bootstrap is a statistical technique used to evaluate the reliability of nodes in a…

Q: Can you make a model that shows how blue eyes originated? Can you include genes, chromosomes,…

A: Punnett square is a graphical tool that predicts the likelihood of offspring inheriting certain…

Q: • am WTD phenotype individual with parents that Loere frue - breeding (LOPD) x up() completely…

A: NOTE- Please whenever you post any question , if you post it in hand written form make sure to post…

Concept explainers

Hematology

Hematology is the branch of biology. Hematology is the medical field that deals with the treatment of blood disorders and cancers, such as hemophilia, leukemia, lymphoma, and sickle-cell anemia. Hematologists and hematopathologists are medical professionals who specialize in illnesses of the blood and its components.

Question

5' carbon =

3' carbon =

hydrogen bond =

phosphodiester bond =

phosphate group =

deoxyribose sugar =

nitrogenous base =

OM₂N
Tod
NH N
P=0
HOP=O
NH₂O
"N **** HN
•H₂N
D
F
01PIOH
G
O=P OH
H₂N
H
PORK
-OH
On the diagram of a DNA molecule above, select the letter that labels the
each component listed below.

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

DNA contains many hydrogen bonds. Are hydrogen bonds stronger or weaker than covalent bonds? What are the consequences of this difference in strength?
A beginning genetics student is attempting to complete an assignment to draw a base pair from a DNA molecule. The drawing is incomplete, and the student does not know how to finish. He asks for your advice. The assignment sheet shows that the drawing is to contain three hydrogen bonds, a purine, and a pyrimidine. From your knowledge of the pairing rules and the number of hydrogen bonds in A/T and G/C base pairs, what base pair do you help the student draw?
Chemical analysis shows that a nucleic acid sample contains A, U, C, and G. Is this DNA or RNA? Why?
For the following DNA sequence: 3’–CGATACGGCTATGCCGGCATT–5’ Write: a) the sequence of the complementary DNA strand
A strand of DNA contains the base pair 5’-T-C-A-G-C-A-T-3’. Give the base sequence onthe complementary DNA strand.
Given the DNA molecule, draw the complementary piece under: TAGCTTAGCG
If the sequence of one strand of a DNA molecule is 5’-AGCCCCGACTCTATTC-3’, what is the sequence of the complementary strand?
In one paragraph, using your own words, describe the structure of DNA. Be sure to include the following terms: nucleotide, phosphate, adenine, cytosine, guanine, and thymine.
Type the matching bases in each DNA sequence. G A T A G C T A G G
Below is the sequence of a single strand of a short DNAmolecule. On a piece of paper, rewrite this sequenceand then write the sequence of the complementarystrand below it.GTTCGCGGCCGCGAACComparing the top and bottom strands, what do younotice about the relationship between them?
One half of a DNA strand has the following sequence of bases GCTACGGCGTTATCCCC. What would appear on the other half? A. CGATTCCGCAATAGGGG B. GCTAAGGCGTTATCCCC C. CGATGCCGCAATAGGGG D. ATAGGAATACCGCTTTT E. TATCCTTATGGCGAAAA
For DNA ORF ATG.CTG.GTA.CTN.GTA.AAA, where N stand for any nucliotide (A, T, G, C) claculate the probablity of occurance of any nucliotide at position N.