Phosphorylation of elf-2 regulates eukaryotic protein synthesis initiation by inhibiting formation of the pre-initiation complex. Select one: True False
Q: Name the primary and secondary lymphoid organs.
A: Lymphoid organs are the tissues and organs in which the development, maturation, and proliferation…
Q: Make a Bracket/parallel dichotomous key
A: The identification keys published by taxonomists and used by all manner of end-users of taxonomic…
Q: . Poisons, bacterial invasions, and allergies are examples of A. Types of direct causes of…
A: Poisons, bacterial invasion and allergies can affect animal body adversely and can cause…
Q: In peas, yellow pods are dominant to green pods. Show the results of a cross between a pure yellow…
A: Dominant trait is the one which is expressed even in presence of a recessive trait whereas a…
Q: Question 18 Mark is allergic to pollen of Quercus sp., so he needs to take extra care in: Early fall…
A: Note- As we are allowed to do one question at a time. I will answer only one question. Kindly repost…
Q: 16 Mosquitoes pose a constant health risk in Florida. Based on the illustration above, what would be…
A: To reduce mosquito numbers :-
Q: why is it important to donate the red cells, plasma, platelets Handwritten please
A: Red blood cells contain hemoglobin. Hemoglobin carry oxygen to all over the body. Red blood cells…
Q: main developments in hominin
A: Human evolution is the evolutionary process within the history of primates that led to the emergence…
Q: You are given two data sets that provide counts of F1 and F2 offspring with given genders and…
A: The data are generated from an initial parental cross. One parent displays the disease phenotype and…
Q: A ghost shrimp is the dominant estuarine macroinvertebrate in the sediment along Amero-trailing…
A: Ghost Shrimp, also called as Glass Shrimp, are a type of decapod crustacean that lives in rivers and…
Q: Match the following with their appropriate descriptor: 1. Homozygous Dominant hh xhy 2. Heterozygous…
A: Homozygous Individuals carrying two identical alleles (RR or rr) are known as homozygous.…
Q: To maximize the axial resolution of an ultrasound image, an anesthesiologist would use which of the…
A: When an electric current is supplied to a group of piezoelectric crystals, an ultrasound wave is…
Q: does having different genes cause differences in epigenetic patterns between individuals?
A: While hereditary changes can modify which protein is made, epigenetic changes influence quality…
Q: What is the trend in the data during the first 12 years of the periodshown? Draw a line through the…
A: The development and use of statistical approaches to a wide range of problems in biology is defined…
Q: Do you think the human species can continue raising itsglobal carrying capacity? Why or why not? Do…
A: The growth of a population is explained by a logistic or exponential model.
Q: With respect to nematode reproduction and reproductive structures, which of the following statements…
A: Nematodes are roundworms belonging to the phylum Nematoda and part of the Kingdom Animalia. they are…
Q: From the information given, is this gene imprinted maternally or paternally? Explain your answer…
A: Albright syndrome is a genetic disease that is regulated by genomic imprinting. Genomic imprinting…
Q: 85. According to the U.S. Census Bureau, Population Division, in February 2016, there was one birth…
A: An mismatch among births and deaths is the fundamental (and possibly most evident) driver of…
Q: Choose any natural ecosystem (terrestrial, freshwater, marine). Construct a conceptual diagram…
A: Freshwater includes the freshwater reservoirs like lakes, rivers, stream and the biotic and abiotic…
Q: Use the following cross to answer the questions: What is the probability of obtaining offspn a. Show…
A: Alleles are different versions of a gene that are found on the same homologous chromosome but have…
Q: Do different genes affect epigenetics and variations in epigenetic patterns between individuals?
A: Genes patterns
Q: Which of the following statements below is incorrect? * A. the genetic code is overlapping B.…
A: As per guidelines, you have asked multiple questions we will solve the first question for you. If…
Q: What is the order of ZYA on the lac operon
A: An operon is a group of genes that share a promoter and a regulator and are also transcribed as a…
Q: You discover a microbe that you believe is the causative agent of a new disease. Using Koch's…
A: Microbiology is the study of microorganisms and associated topics. Microbiology has gone a long way…
Q: Are current exposures of bisphenol A enough to be a concern to human health?
A: BPA bisphenol is a dangerous compound when exposed in higher amount it can causes several serious…
Q: Answer the following questions given the pedigree below. Please assume that no other mutations are…
A: A pedigree chart is a type of diagram that shows the occurrence and appearance of phenotypes of a…
Q: EVOLUTION Case for (Very) Early Cooking Heats Up Nearly two million years ago our ancestors began to…
A: Here I answered the question according to article provided in question.
Q: to moderm form they became O More gracile More robust More primitive All of the above None of the…
A: More gracile. Modern people are often more light-weight (or "gracile") than ancient humans, who were…
Q: What is the chance that a man with type A blood, with a type-O mother, and a woman with type B…
A: The ABO blood grouping is controlled by a gene 'i' it has two alleles. The iA and iB alleles are…
Q: Create three Venn Diagrams. For the first diagram, identify two or three similarities and…
A: Eukaryotes are the organism which possess true nucleus and membrane bound organelles . Eukaryotic…
Q: 2. In the sports camp, a group of students have been intensively swimming in a pool for 60 minutes…
A: Skeletal muscles require ATP for contraction to sustain physical activities.
Q: Which of the following labeled structures is meristematic?
A: As per biologists the "root system" is made up of roots that are located under the ground's surface.…
Q: Why is feedback important in the body? Give an example on how our body uses the pairing of stimulus…
A: The process of inhibiting or stimulating the first step by the final step in a hormonal reaction…
Q: a.
A: A. X linked recessive disorder X-linked recessive inheritance refers to genetic conditions…
Q: Extinction is a natural phenomenon. It is es 99% cles that ever lived are now extinct. Why then do…
A: ANSWER) (b) Scientists have finally identified most of the species on Earth and are thus able to…
Q: o achieved homeostasis, the nervous system and endocrine system maintain Normal range of the…
A: The endocrine system collaborates with the neurological system to keep the body in a state of…
Q: Q1/ Could where you live influence how long you live?
A: Yes, could where you live influence how long you live. These days environment pollution are raised…
Q: all that apply) a. an annealing step at 50 degrees so primers can bind b. an extension step where…
A: PCR is a process for synthesising artificial genes using dNTPs, primers, Taq DNA polymerase, and…
Q: Original strand: G G G C T A G G G C C A A , Mutant strand: G G G G C T A G G G C C A A . What type…
A: According to our guideline we can answer only the first three subparts of a question. So, please…
Q: 3. A plasmid was cleaved with several restriction enzymes, individually and in combinations. The…
A: Restriction mapping is a technique for mapping an unknown section of DNA by breaking it down into…
Q: For the statements below tell which from the list below applies 1. meiosis 2. mitosis 3. neither…
A: Cell division is a process by which new cells are formed.
Q: 2. Calculate the number of ATP molecules generated by the following net reactions of the citric acid…
A: ATP It is the energy giving molecule of the cell. Adenosine Triphosphate use to produce energy in…
Q: Why does carcinoma of the ascending colon cause more anaemia than obstruction, and carcinoma of the…
A: Ca colon is a very common cancer in developed countries starts from the inner wall of the colon and…
Q: Why are offspring of oviparous animals at a greater risk as compared to offspring of viviparous…
A: Oviparous animals are those which lay eggs. Viviparous animals are those which give birth to young…
Q: If a bird tries to eat a monarch butterfly, it throws up because monarch butterflies harbor toxins…
A: Adaptation is necessary for living creatures to survive. Animals who are unable to adjust to changes…
Q: What gene expression question could you answer using data from the ENCODE website
A: Gene expression includes the synthesis of an RNA transcript from a DNA template and translation of…
Q: What is/explain stochiometry matrix for lac operon model
A: The transcription state of a genome is controlled by complex regulatory networks. These…
Q: antibody screening and identifications
A: Abstract BACKGROUND AND OBJECTIVES: The aim of the blood transfusion service should be to provide…
Q: Based on this data, which of the following is true of the cell lines? Select all that apply Cell…
A: Oncogenes are produced by the activation of proto-oncogenes. A point mutation is one of the causes…
Q: What are two environmental conditions that might lead to the disappearance of manatees from…
A: The common name of Manatees is sea cows. Trichechus is the scientific name given to manatee. They…
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- Name two similarities and two differences between the cellular processes of importing protien into the ER and importing protein to the nucleus.Place the steps below in the correct order to accurately reflect the steps by which a secretory protein is co-translationally imported into the lumen of the endoplasmic reticulum: As the polypeptide elongates and translocates into the ER, the signal peptidase cleaves the signal peptide. The SRP binds the SRP receptor, directing the ribosome to dock on the ER membrane. Termination of translation, results in the release of the polypeptide into the ER lumen, release of the ribosome from the ER membrane, and closing of the channel. The signal recognition particle (SRP) binds to the signal sequence on a newly synthesized polypeptide and stalls translation. The channel in the ER membrane opens and the polypeptide is inserted into the ER lumen. The SRP is released. A.6-4-2-3-1-5 B.4-2-5-1-3-6 C.3-1-6-2-4-5 D.1-2-3-4-5-6 E.2-6-1-5-4-3Describe results that could be obtained from ribosomeprofiling that would indicate the existence of aregulatory mechanism operating at the level oftranslational initiation.
- During Chain ________ Each Incoming Aminoacyl-tRNA Moves Through Three Ribosomal Sites.Would a chimeric translation system containing thelarge ribosomal subunit from E. coli and the small ribosomal subunit from yeast (a unicellular eukaryote) beable to function in protein synthesis? Explain why orwhy not.Define the following terms:a. cotranslational transferb. posttranslational transferc. TOM receptor proteind. TIM complexe. mthsp70
- What are the functional consequences of this deletion for lilP mRNA transcription and translation? (100 words max.)Give typing answer with explanation and conclusion to all parts What would happen to the overall process of making proteins (transcription-translation) if the pores in the nuclear envelope were blocked? Q10. Suppose that an mRNA transcript consists of the following sequence of bases: AUGCCAGGUUAUGUCUAG. a. What sequence of amino acids would this translate to? b. Now suppose that a mutation takes place in the DNA so that twelfth base changes from U to G. How does this change the meaning of the 4th amino acid? (I.e., what does it change to?) c. Would the result be a normal protein? EXPLAIN SPECIFICALLY WHY OR WHY NOT.Referring to the genetic code presented in Figure , give the aminoacids specified by the following bacterial mRNA sequences. Q. 5′ –AUGUUUAAAUUUAAAUUUUGA–3′
- Explain why energy is NOT needed for co-translational translocation but IS needed for post-translational ER translocation of an ER lumenal protein.Describe the prokaryotic translation initiation shown in the diagram. Define the convention of protein synthesis (directionality of synthesis) as well as the meaning of the A, P, and E sites of the ribosome.Discuss the key factors & mechanisms during co-translational translocation by which START TRANSFER and STOP TRANSFER sequences help the protein generate appropriate number of transmembrane regions with N or C terminal on the designated side of the plasma membrane.(NO PLAGIARISM)