Place the following eukaryotic DNA structures in order of thickness, smallest to largest heterochromatin double helix nucleosomes 30 nm chromatin fibre looped domain
Q: Which of the following statements are correct? explain your answers.A. each eukaryotic chromosome…
A: DNA is the double-stranded molecule that is the genetic material in most animals except for some…
Q: In the image below, which arrow denotes the protein that forms the nested DNA loops in chromatin?…
A: Linker histones (H1 and its variations) or HMG proteins bind lengths of DNA that connect adjacent…
Q: Estimate the length of human largest chromosome 1 consisting of 248,956,422 base pairs (bp) DNA…
A: Here, length of DNA = No. of base pairs × distance between the two base pairs
Q: Chromatin of eukaryotes is organized into repeating interactions with protein octamers called…
A: Deoxyribonucleic acid is a particle made out of two polynucleotide chains that loop around one…
Q: In a nucleosome, the DNA is wrapped around ribosomes a thymine dimer polymerase molecules histones
A: Nucleosome Nucleosome is a segment of DNA that wrapped around a protein core.
Q: Which of the following solves the problem of shortening of chromosomes in each cell cycle?a) DNA…
A: The DNA replication mechanism is a semiconservative replication in which the parent DNA acts as the…
Q: In nucleosome, the DNA is wrapped around a. histones b. ribosomes c. polymerase molecule d. a…
A: The nucleosome is the fundamental subunit of chromatin. They are structural building blocks of the…
Q: Which of the following is not a major class of chromatin proteins?a) Histonesb) Topoisomerasesc) SMC…
A: Chromatin is the material that makes up a chromosome that consists of DNA and protein. Chromatin…
Q: Letter 'c' corresponds to 5' 5' 3' 5' 3' 5' leading strand. daughter strands. lagging strand.…
A: Replication is the process in which the DNA is copied in the cell. The figure represents the typical…
Q: What term best describes a entity with the following characteristics? in eukaryotes, a long, linear…
A: Question - in eukaryotes, a long, linear strand of double-helical DNA wrapped around nucleosomes,…
Q: A _is a structure made of DNA that is condensed and coiled around proteins into a definite shape…
A: DNA is the genetic material present in the nucleus. It stores the information for carrying out all…
Q: Define the following terms:a. nucleoplasmb. chromatin fiberc. nuclear matrixd. nucleoluse. nuclear…
A: The nucleus is a membrane-bounded cell organelle that contians genetic material in the form of…
Q: Which of the following are essential to the condensation of chromosomes as cells enter mitosis?a)…
A: Mitosis is a process of cell division in which a cell nucleus splits into two resulting in the…
Q: Define the following terms:a. positive supercoilingb. negative supercoilingc. polyaminesd.…
A: Introduction DNA (Deoxyribonucleic acid) is a hereditary material that contains all of the genetic…
Q: How many copies of the H2B histone would be found in chromatin containing 50 nucleosomes? a. 5 b. 10…
A: The defined length of DNA is attached to a collection of histones called octamer. The total unit is…
Q: Nucleosome is a level of DNA packaging in eukaryotic cells, it consists of DNA segment around three…
A: A nucleosome is the basic structural unit of DNA packaging in eukaryotes.
Q: Which of the following statements regarding DNA synthesis at the ends of linear chromosomes is true
A: DNA replication DNA replication is a process in which the amount of DNA gets double before the…
Q: For each of the following pairs of chromatin types,which is the most condensed?a. 100 Å fiber or 300…
A: There are four levels of condensation: Nucleosome – DNA is tightly complexed with histones, wrapping…
Q: Consider the figure beow, which depicts chromatin within the neucleus of a eukaryotic cell. nucleus…
A: Topologically associating domain (TAD) also called chromosomal interacting domains in bacteria. They…
Q: Describe in 4 steps the condensation of eukaryotic DNA to chromosomes. Describe each one briefly.…
A: In mitosis, the nuclear DNA of the cell condenses into visible chromosomes and is pulled apart by…
Q: The nuclear matrix composition: a. lamina, nucleosome b. cortex, lamina, c. nucleosome d. lamina,…
A: The nuclear matrix is described as a type of structure that majorly comprises non-histone proteins.…
Q: Put the following structures in order from smallest to largest. chromosome (DNA) eukaryotic cell…
A:
Q: Some portions of the chromosomes are coiled with inactive genes as electron- dense masses of…
A: DNA(deoxyribonucleic acid) is a molecule comprised of two polypeptide chains that coil around each…
Q: Chromatin condenses. Name: Homologs aligned by synapsis and chromosomes are compact. Name:
A: Mitosis and meiosis are the type of cell divisions which are required for growth and cell division.…
Q: Which of the following plays a substantial role in linking together sister chromatids immediately…
A: Cell division is a process in which a parent cell is divided into two daughter cells. The cell…
Q: Which one of the following entries most accurately states the number of DNA double helices…
A: A chromatid is one of two identical halves of a replicated chromosome.
Q: A region made up of repetitive sequences in chromosomal DNA where the chromatid is attached.…
A: In eukaryotes, chromosomes are thread-like structure present in the nuclei of a cell. Chromosome…
Q: Which of the following terms should not be used to describe aBarr body?A. ChromatinB. EuchromatinC.…
A: Barr body or sex chromatin body is one of the two inactive X-chromosomes in mammalian female cells.…
Q: What structure of the nucleus has the function of transporting small molecules through the nuclear…
A: The nucleus is an important membrane-bound organelle in a eukaryotic cell that houses the genetic…
Q: Which of the following is the most compact level of chromatin structure? Metaphase chromosomes…
A: Metaphase chromosomes is the most compact level of chromatin structure.
Q: Histone _______ is not part of the histone octamer, but binds to linker DNA and is responsible for…
A: Histones are a family of basic proteins that associate with DNA in the nucleus and help condense it…
Q: Segregation refers to which of the following? homolog pairing O recombination ploidy reduction DNA…
A: Chromosome segregation or segregation of genes take place at Anaphase of meiosis. Chromatid…
Q: Which of the following represents the order of increasingly higher levels of organization of…
A: Histones octamer play a key role in the packaging of DNA. DNA wraps the core histones and forms the…
Q: Construct a concept map with the following terms: Eukaryotic chromosome, euchromatin,…
A: DNA refers to the organism’s genetic material that can be found in the eukaryotic cell’s nucleus.…
Q: Choose the CORRECT order of compaction of DNA in eukaryotes. DNA → nucleosome → loops → fiber →…
A: The haploid human genome contains around 3 billion base sets of DNA bundled into 23 chromosomes.…
Q: Some portions of the chromosomes are coiled with inactive genes as electron-dense masses of…
A: Packaging of DNA: The DNA in eukaryotes is assembled into chromatin, which are complexes made of…
Q: Which of the following statements concerning eukaryotic chromatin is true. Histones have an…
A: Eukaryotic chromatin is made up of protein and DNA . It consists of beads referred to as nucleosome.…
Q: Put the following levels of chromosome organization in order from least complex (least packaged…
A: The word chromosome arises from the Greek word chroma means color and soma which means body because…
Q: Describe heterochromatin and euchromatin when viewed under an electron microscope
A: Euchromatin and heterochromatin are the parts of chromatin discovered by E. Heitz in 1928.…
Q: During mitosis the chromosomes line up in the middle of the cell are copied all of the above are…
A: Question 11 During mitosis a cell divides to form two daughter cells and the daughter cells have…
Q: ntains only a single, linear chromosome consisting of 7x10^6 nucleotide pairs of DNA coalesced with…
A: The histone protein is an octameric protein that wraps around the DNA. These proteins have a…
Q: Many chromosomes have structures called telomeres at each end. Mark all the TRUE statements about…
A: Telomeres are the non-coding, repetitive sequences present at the end of chromosomes which are often…
Q: A nucleosome consists of (a) DNA and scaffolding proteins (b) scaffolding proteins and histones (c)…
A: A nucleosome is defined as a 3D structure composed of approximately two turns of DNA wrapped…
Q: DEfine Nucleosome
A: Chromosomes are long-thread like structures that carry coded genetic information in the form of…
Q: Letter 'b' corresponds to 3' 5' 5 3' 5' 3' 3' 5' O leading strand. lagging strand. daughter strands.…
A: DNA replication is a crucial step as name suggests replica of a DNA (two replicas) is formed by…
Q: Arrange the levels of chromatin packing from most "open" to most condensed (chromosome, loops,…
A: Chromatin is a complex combination of DNA and proteins that makes up the chromosomes within the…
Q: In eukaryotic cells, chromosomes are composed of _____. DNA and proteins DNA only DNA…
A: In the nucleus of eukaryotic cells, DNA is organized into a thread-like structure with the help of…
Q: Mach the terms left with as many terms GMP Nucleotide at right by entering @ Nucleoside 3 Z-DNA…
A: Thank you for your question, Here is the answers for the above match the following with…
Place the following eukaryotic DNA structures in order of thickness, smallest to largest
heterochromatin
double helix
nucleosomes
30 nm chromatin fibre
looped domain
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- Define the following terms: a. chromosome b. chromatinPut the following levels of chromosome organization in order from least complex (least packaged form) to most complex (most packaged form). DNA strand 30-nm fiber Heterochromatin EuchromatinNucleosomes are the ball-like structures around which the double helix winds. What proteins make up nucleosomes? Group of answer choices hertone histone heterochromatin euchromatin
- Which of the following DNA types forms the nucleolar organizer (nucleolus)? centromeric heterochromatin telomeres minisatellite rDNA clusters histone gene clustersEukaryotic DNA is typically organized into two major regions called euchromatin and heterochromatin. Which of the following applies to euchromatin? They are regions of little or no transcription activity. They are regions of highly condensed chromatin. They are regions that are uncoiled and active in transcription. They may refer to regions near the ends of chromosome (telomeres). They refer to regions that contain the centromere.Which of the following statements are correct? explain your answers.A. each eukaryotic chromosome must contain the following DNA sequence elements: multiple origins of replication, two telomeres, and one centromere.B. Nucleosome core particles are 30 nm in diameter.
- Which structure in the eukaryotic chromosome is about 11 nm in diameter, contains 8 histone proteins and a short region of double-stranded DNA, and is easily accessible to transcription? the heterochromatin the supersolenoid the radial minibands the solenoid the nucleosome. Which structure in the eukaryotic chromosome is about 2 nm in diameter, contains no histone proteins associated with double-stranded DNA, and is easily accessible to transcription? the heterochromatin the nucleosome the solenoid the naked DNA the radial minibandsIf the DNA of chromosome 1 is fully extended, it will exceed the diameter of the nucleus of a cell by about 15,000 times. Therefore, discuss how DNA is packaged into the cell.
- Define the following terms:a. histonesb. heterochromatinc. euchromatind. intergenic sequencese. tandem repeatsFor the following DNA sequence: 3’–CGATACGGCTATGCCGGCATT–5’ Write: a) the sequence of the complementary DNA strandThe structural unit of the eukaryotic genome is called a(n): a. nucleosome b. histone c. chromatin d. exon
