Answered: please answer asap! ty!!! Why are…

Name: please answer asap! ty!!! Why are phosphorylation, acetylation and met
Uploaded: 2024-03-20T06:43:04.000Z
Channel: Bartleby
Description: please answer asap! ty!!! Why are phosphorylation, acetylation and methylation of proteins considered tobe molecular switches and what is theur significance in terms of cellular response to stimuli?

Science

Biochemistry

please answer asap! ty!!! Why are phosphorylation, acetylation and methylation of proteins considered to be molecular switches and what is theur significance in terms of cellular response to stimuli?

Biology 2e

2nd Edition

ISBN:9781947172517

Author:Matthew Douglas, Jung Choi, Mary Ann Clark

Publisher:Matthew Douglas, Jung Choi, Mary Ann Clark

Chapter9: Cell Communication

Section: Chapter Questions

Problem 20RQ: Which type of molecule acts as a signaling molecule in yeasts? steroid autoinducer mating factor...

See similar textbooks

Similar questions

Please help me answer the TRANSLATION AND PROTEIB SYNTHESIS 1. Beginning with DNA, describe in simple terms (no specific codons, etc.) how protein are coded and synthesized. 2. List down the three major stages in protein synthesis Thank you very much for your help.
Please help me answer the GENETIC CODE 1. What is a codon? 2. For eaxh of the following mRNA codons, give the tRNA anticodon and determine the amino acids being coded for by the codon. - UAU - CAU - UCA - UCU Thank you
31 Changes in function of which of the following protein by posttranslational modification (such as phosphorylation or acetylation) would be most likely to, in turn, affect the expression of specific genes? Question 31 options: TFIID Histone TATA-binding protein AP-1 complex Previous PageNext Page
Please ASAP. Thank you A nociceptor-specific knock-out mutation of Nav1.3 in mice resulted in typical neuropathic pain behavior. What genetic technique was used to create this site-specific mutation?
Question:- 1. Describe an assay that could measure the activity of adenylyl cyclase (AC).
Need help. A protein X binds Ligand Y. The kon characterizing this binding is 1 x 106 M-1s-1, koff is 2 x 10-3 M-1s-1. In your in vitro X-Y binding experiment, at what concentration of Ligand Y half of the Protein X would be bound to Y. Assume that the binding is according to the Lock-and-key model
Good afternoon, Guidance with this question would be most appriciated. Thank you for your time. Polypeptide sequences are formed from 20 amino acids. What is the probability that a single point mutation in a gene will result in a different polypeptide sequence?
answer all the three given sub questions. If not, will give thumbs down I. TRUE OR FALSE1. A mutation is considered induced when a bacterial cell is exposed to harsh environmental conditions and developed a resistance mechanism against beta-lactams 2. One example of a bacterial phenotypic expression is Gram's reaction 3. Which of the following phases in the bacterial growth curve indicates depletion of available nutrients leading to the accumulation of metabolic waste leading to cell death
Please answer all questions GTTTTCACTGGCGAGCGTCATCTTCCTACT 5. Calculate molecular weight (kiloDalton, kD) and calculated pI (the pH where the protein carries no net electrical charge) of the protein.6. Provide the reference (in proper reference form: Author; Year; Title; Journal Name; Volume; Page Numbers) for a recent publication involving the identified gene. This reference should NOT be a web page reference.7. Are there homologs for the identified gene in other systems? Identify one homolog in an invertebrate system (if there is none, provide a vertebrate homolog).8. What is the function (e.g. transcriptional regulation, transmembrane signaling, kinase, protease, etc.) of the protein(s) encoded by the gene.9. Generate a FULL protein sequence alignment for one of the identified putative protein products with at least one similar invertebrate protein (if there is none, use a vertebrate homolog).10. Generate a secondary structure prediction for one identified protein.
fill in the blanks ASAP 10 min 1. ___________ occurs when the number of protein kinases activated in a signal transduction pathway increases as the message is relayed down the transduction pathway. 2. which contains more potential energy, 225 grams of glucose or 225 grams of fat?
Question: Hi, can someone help me with this question thanks in advance. Select one of the following genetic diseases that appear in the following list:galactosemiacystic fibrosisDown's Syndromefamilial hypercholesterolemiamuscle gystrophyHuntington's diseasesickle cell anemiahemophiliaTay-Sachs diseasedescribe a composition about how the selected condition is generated. Include details about the number of people who report the disease, symptoms, treatments, among other aspects that you consider important. thanks
Yes or no? reverse genetics is RNA interference example. cellular differentiation potency in multipotent is greater than pluripotent stem cell. does digoxigenin UTO use to make dsrna and perform rna interference?