Please write down the DNA sequence inferred from the below DNA gel. Shown are the products of a dideoxy sequencing reaction.
Q: in the series: SCD, TEF, UGH, ___, WKL what letters should fill the blank
A: The first letter of an element in the series is consecutive to the previous elements first letter…
Q: HN 1. 2. 3. 4. 5. NH CH₂ EB HẠN–ệ—C H 8 Choose A if the statement is CORRECT B if the statement is…
A:
Q: Part 1: Draw the following metabolic pathways and identify different types of organic reaction…
A: Since you have posted a question with multiple sub-parts, we will solve the first three sub-parts…
Q: Draw the Gluconeogenesis pathway (pyruvate to glucose) and identify at most 5 different organic…
A: Gluconeogenesis is a metabolic pathway in which glucose is synthesized from certain non-carbohydrate…
Q: Ceruloplasmin is a blue-colored monomeric oxidase found in mamma- lian blood plasma. It contains…
A: Ceruloplasmin is a copper containing globulin which helps in the transport of copper in the…
Q: 1. Explain why egg white and milk are used as antidotes in heavy metal poisoning. 2. Surgical…
A: 1. The egg white and milk are used as antidotes for heavy metal poisoning because the egg white and…
Q: Question 1 Which of the following conditions would fail to produce a triacylglycerol? Group of…
A: Triacylglycerol : A triglyceride or triacylglycerol (TG) molecule is made up of a glycerol as…
Q: The Worthington's manual reports two extinction coefficients for lysozyme. Corvert one into the…
A: A spectrophotometer can measure the amount of light absorbed by a biomolecule and we can use that…
Q: Compare and contrast fermentation, aerobic respiration, and anaerobic respiration in BACTERIA. Be…
A: Fermentation of is a partial oxidation or reduction of sugars to other organic compounds.…
Q: If a dialysis tube that is permeable to water but not sucrose contains a 40% sucrose solution that…
A: Water travels across a semi-permeable membrane from the side of the membrane with a lower…
Q: Fetal hemoglobin binds 2,3 BPG with greater affinity than adult hemoglobin. True False
A: Growing fetuses' receive oxygen and other nutrients from their moms. Fetal hemoglobin is the…
Q: The side chain of which of the following amino acids is most hydrophilic a. Phe b. Val c. Leu d.…
A: The hydrophobicity or hydrophilicity of the amino acids in a protein is quantitatively analysed…
Q: Describe the differences between lecithin and cephalin. Draw the structure of a glycerophospholipid…
A: Glycerophospholipids are a class of lipids found in all forms of life. It has Glycerol as its…
Q: . Millions Test Color of Millon's reagent: Sample glutamic acid tyrosine casein albumin gelatin…
A: DISCLAIMER FOR MULTIPLE Since you have asked multiple question, we will solve the first question…
Q: a. Pentapeptide with aminopeptidase releases an amino acid which gives a black precipitate with lead…
A: Penta peptide is a sequence of 5 amino acids. It has 4 peptide bonds joining the Amino acids. The…
Q: a. Provide a name for both metabolites. b. What kind of reaction occurs here? c. What enzyme…
A: In glycolysis, a 6-carbon molecule of glucose-6-phosphate is broken down into 3-carbon pyruvate. It…
Q: Give 2 examples of enzymatic reactions regulated allosterically and one example of a "cascade"…
A: In allosteric regulation of enzyme, an effector molecules bind to an enzyme at a site other than the…
Q: A mixture of the following amino acids (glu, leu, val, arg, ser, phe) was obtained upon complete…
A: The following amino acids (glu, leu, val, arg, ser, phe) were obtained from complete hydrolysis of a…
Q: What is the purpose of soaking the egg in vinegar? Explain the rationale of vinegar reaction to the…
A: Since you have asked multiple questions, we will solve the first question for you. If you want any…
Q: What effect do different sugars/sweeteners and different quantities of such sweeteners on the…
A: The following ingredients are commonly found in ice cream: Fat, dairy or non-dairy Milk…
Q: A. Will decreasing the amount of energy needed to make an exergonic reaction occur cause the…
A: The thermodynamics of a chemical reaction focuses on the energetics of the products and the…
Q: Starting from glutamine ,glycine, aspartate, N-10 formal-ThF ,how many ATP equivalents are required…
A: Glutamine : It is the most abundant amino acid in the body.It is synthesized in the muscles and the…
Q: We need to prepare a stock solution of medium for your culture cells, which usually includes liquid…
A: The preparation of buffer is a crucial step in biochemistry and molecular biology experiments. The…
Q: Consider the peptides Pro-Gin-Val-Phe-His-Asp-Cys and His-Gln-Pro-Cys-Asp-Phe-Val. How do these two…
A: Note: Hi! Thank you for the question. We are authorized to answer one question at a time. Since you…
Q: 27. While culturing some cells, you lower the temperature of the culture. What happens immediately…
A: Cell membrane are composed of lipid bilayer and proteins. Membrane fluidity depends on the content…
Q: Identify the components of animal fatty acid synthase (FAS). acyl-CoA dehydrogenase B-ketoacyl…
A: Enzymes are highly specialized proteins that have extraordinary catalytic power, greater than that…
Q: how would you prepare a 3-fold dilution series
A: Serial dilution : A substance is diluted in a solution step by step in a serial dilution procedure.…
Q: II. True or False a. An effort is usually made to fragment the polypeptide backbone first, before…
A: Proteins are the heteropolymers of twenty standard amino acids that differ from each other on the…
Q: Draw the Biosynthesis of fatty acids from Acetyl CoA pathway and identify the different types of…
A: The biosynthesis of fatty acids from the acetyl-CoA occurs in the cytosol. It involves the addition…
Q: In biochemistry,what is the main function of amide group and carboxyl group on amino acids?which one…
A: Proteins are made up of amino acids. When few amino acids are joined, the formed structure is called…
Q: True or False: Phosphoryl groups are added to enzymes to increase their activity. *If this…
A: The enzymes are biological catalysts that are mostly protein in nature. The activity of an enzyme…
Q: Show the Hydrolysis of a dipeptide containing the amino acids threonine and methionine.
A: Amino acids are joined together in a linear manner by peptide linkage, known as the primary…
Q: The condensation reaction catalyzed by ß-ketoacyl-ACP synthase synthesizes a four-carbon unit by…
A: Malonyl CoA is formed from carboxylation of Acetyl CoA through an ATP consuming process by biotin…
Q: lon concentrations ION ECF K+ 4 mM Na+ 150 mM CI- 108 mM ICF 145 mM 12 mM 10 mM Eion = The table…
A: Resting membrane potential can be calculated by using the Nernst equation, if the membrane potential…
Q: What is the product of the oxidation of this fatty acid?
A: The aerobic fatty acid oxidation mechanism in the mitochondria converts a fatty acid into acetyl-CoA…
Q: 9. Four molecules of ATP are necessary to convert one OAA to PEP. T F
A: OAA is converted to PEP during gluconeogenesis. Enzyme PEP carboxylase catalyzes this reaction.…
Q: Count Experiment Name: Specimen Name: Tube Name: Record Date: SOP GUID Display Range Population P1…
A: The flow cytometry data in the given image uses BV-605 as the fluorescent molecule. From the…
Q: 3. For clopidogrel, draw the structure of clopidogreli and label the structure with its indication…
A: Clopidogrel is a pro drug that upon activation by the liver enzymes becomes an active metabolite.…
Q: 15.5 Identify the acid-base conjugate pairs in each of the following reactions: (a) CH₂COO + HCN (b)…
A: An acid is defined as the donator of protons and a base is defined as the acceptor of protons. Acid…
Q: Water-soluble proteins such as myoglobin tend to fold such that: OA) hydrophobic amino acids…
A: Myoglobin, a globular protein, contains a single polypeptide chain of 153 amino acid residues and a…
Q: Identify the different functions of the genes coded in the lac operon region.
A: Operon is a set of linked genes that codes for proteins that are functionally related. lac operon is…
Q: Conversion of disaccharides to monosaccharides are associated with: O stomach O intestinal mucosa…
A: Chemically carbohydrates are polyhydroxy aldehydes or ketones. They have the general formula :…
Q: Describe what you know about enzymes. Toxic hydrogen peroxide
A: Note: Hi! Thank you for the question. We are authorized to answer one question at a time. Since you…
Q: Give the structure and the corresponding function of Inulin.
A:
Q: Discuss in detail about the structure of protein .
A: Proteins are one of the four major biomacromolecules. Proteins can be composed of one or more…
Q: An allosterically regulated enzyme in the R state is unable to bind substrate at the active site.…
A: Allosteric site : It is a place or site on an enzyme where the molecule which is not a substrate can…
Q: Determine the interactions shown in the figure at point P * M N R.. CH₂ O Hydrophobic interaction O…
A: the interactions shown in the figure at point P a)Electrostatic interaction b)Covalent bonding…
Q: 1. Regarding nucleosome structure, which of the following statements is correct? A. Nucleosomesare…
A: Chromatin is a complex made of DNA and protein in equal proportion along with small amounts of RNA.…
Q: oles of: • Proline • Hydroxyproline • Hydroxylysine
A: Amino acids are biomolecules in which an amino group and a carboxyl group are linked to the same…
Q: Consider the malate dehydrogenase reaction from the citric acid cycle. Given the listed…
A: Malate dehydrogenase catalyses the reversible conversion of malate (MAL) to oxaloacetate (OAA),…
Please write down the DNA sequence inferred from the below DNA gel. Shown are the products of a dideoxy sequencing reaction.
Step by step
Solved in 2 steps with 1 images
- The DNA sequence ATGCATGC will pair with which of the following DNA strands? TACGTACG TACCTACC CGTACGTA ATGCATGC TTGCATCCA DNA strand has the following sequence: 5’-GAACCCGATGGCGATACATTTACCAGATCACCAGC-3’ In which direction would DNA polymerase slide along this strand (from left to right or from right to left)? If this strand was used as a template by DNA polymerase, what would be the sequence of the newly made strand? Indicate the 5’ and 3’ ends of the newly made strand.Write down the double stranding sequence of the resulting DNA fragment(s) if the following DNA molecule were digested with XhoI: 5'-GGTATCCGCGGAGCTCAAATA-3' 3'-CCATAGGCGCCTCGAGTTTAT-5'
- The region of DNA, shown below, is being copied. Diagram what happens when the second GT repeat (newly synthesizing strand) slips out (loops out). Diagram what occurs in this and the next round of DNA replication. Describe the change in the DNA sequence that occurs due to this replication slippage. 5’TGCCAGTGTGT3’ACGGTCACACACACATGGAG5’Show the expected labeled cleavage products if the following DNA segment were subjected to each of the four cleavage reactions: 32P-A-A-C-A-T-G-G-C-G-C-T-T-A-T-G-A-C-G-ADuring DNA replication, the template sequence 5' ATAGGCC 3' would produce which one of the following sequences for the complementary strand? a. 5' GGCCTAT 3' b. 5' CCGGATA 3' c. 5' ATAGGCC 3' d. 5' TATCCGG 3'
- If the following piece of the partially double stranded DNA: 5' ATCG 3' 3' TAGCGGCATCCG 5' and add DNA polymerase, dTTP,dGTP and dCTP, what will be the sequence of the nucleotides that will be added? A. 5' ATCGCCGTAGGC 3' B 5' GGCATCCG 3' C. 5' CCGT 3' D 5'CCGTAGGC 3' E 5'GGC 3'For the following DNA sequence: 3’–CGATACGGCTATGCCGGCATT–5’ Write: a) the sequence of the complementary DNA strandin DNA replication, if the template strand is 5’-ATCCGTGTAACCTT-3’, what is the sequence of the newly synthesized DNA strand? Write the sequence from 5’ to 3’.
- COMPLEMENTARY DNA SEQUENCE OF GACGGCTTAAGATGCA DNA strand has the following sequence: 5′–GATCCCGATCCGCATACATTTACCAGATCACCACC–3′In which direction would DNA polymerase slide along this strand(from left to right or from right to left)? If this strand was used as atemplate by DNA polymerase, what would be the sequence of thenewly made strand? Indicate the 5′ and 3′ ends of the newly madestrand.View the given linked video to see the detailed structure of the different kinds of DNA. After analyzing make a simple illustration to relate the different kinds of DNA to its function. https://www.youtube.com/watch?v=o_-6JXLYS-k