pluripotent stem cells have allowed scientists to model various diseases and screen drugs in these in vitro models. Please select a disease (like cancer) that can be modeled through the generation of induced pluripotent stem cells. You can use published literature and explain: 1) why is it important to model such a disease? 2) what were the key findings after modeling such a disease?  3) a drug that has been screened in this disease model. Explain in detail the main findings.

Q: The vertebrae in the upper three regions of the column remain distinct throughout life and are known…

A: Introduction - The spinal column is made up of 33 interconnecting vertebrae. The vertebral body for…

Q: Discuss the strengths and weakness of the traditional Innovative health financing mechanisms

A: The purpose of health financing is to make funding available, as well as to set the right financial…

Q: - What effect does high temperature have on the fluidity of the plasma membrane?

A: as per our company guidelines we are supposed to answer only first 1 question. Kindly repost other…

Q: 7. RSV is a abiotic stress in plants. 8. RSV produced in the root system of plants improves the…

A: Answe :- Stage 1 Here I examine about RSV and their job in plants as indicated by fill in the clear…

Q: Describe how a product generated from glycolysis can be used for ATP production by the electron…

A: * Glycolysis is a metabolic pathway it  converts glucose into pyruvic acid and in this process free…

Q: In prokaryotes, the sigma factor recognizes base sequences in the . which facilitates RNA polymerase…

A: The major step of initiation of RNA synthesis is the facilitation of RNA polymerase binding. This is…

Q: TACTGCCTCCCCATAAGAATT

A: Transcription is the process in which a gene's DNA sequence is copied (transcribed) to make an RNA…

Q: DNA molecule is   A. Acidic   B. Basic

A: I didn't get I have to do just 9th or all  As you didn't mention  But you separately posted 9th…

Q: MULTIPLE CHOICE QUESTION Which of the following is not an example of homeostasis? Chenging…

A: Homeostasis is the phenomena occuring in the living body where constant condition is maintained…

Q: What is Pepsin

A: Digestion of food begins inside the mouth with the help of the enzyme salivary amylase and digestion…

Q: Question 36 Most eukaryotic RNA consists of coding regions, called and noncoding regions, called A…

A: INTRODUCTION Answer to the question 36 is given below.

Q: Which molecules regulate cross-bridge attachment activity? O a. tropomyosin and M lines O b. calcium…

A: The Muscular System is a vital physiological system that humans require in order to exist. This…

Q: 2. When ascorbate is a substrate for the respiratory chain, it is oxidized by passing two clectrons…

A: Ascorbate donates electron to the respiratory chain via cytochrome C and it is added at end of each…

Q: How might diet soda lead to an individual feeling hungry?

A: Introduction A soft drink is a drink made up of water (typically carbonated), a sweetener, and…

Q: 1. What causes the light pink to bright red coloraion of most adult flamingos? 2. Please describe…

A: Introduction Flamingos are a type of wading bird in the family Phoenicopteridae, they are very…

Q: Bat/Hedgehog/??

A: MERS is also called Middle East respiratory syndrome.  It is a contagious, sometimes fatal…

Q: Question 2: Is it just a regular cold or COVID-19? Compare and contrast the two infections. In your…

A: Within the twentieth century, the globe suffered pandemics. The pandemics, as horrifying and lethal…

Q: True or false and explain why. According to the Goldman equation, resting membrane potential of a…

A: * Goldman equation also called as Goldman Hodgkin Katz voltage equation that is used in cell…

Q: ructures commonly present in all vertebrate kidneys?

A: Vertebrates have the following variation of the kidneys: - Pronephros Mesonephros Metanephros

Q: What is the importance of mitosis for the embryonic development?

A: The "cell cycle", also known as "cell division", is a set of processes that occur in a cell leading…

Q: Would it be more advantageous to have hot AND cold receptors in ALL areas of the skin? Defend the…

A: Thermoreceptors are divided into two types: those that perceive warmth and those that detect cold.…

Q: Phosphofructokinase (PFK) catalyzes a key step in glycolysis. This enzyme is composed of three…

A: The most common causes of anemia in the elderly are chronic disease and iron deficiency. Vitamin B12…

Q: Explain why the intersex condition supports the idea that sex and gender are non-binary and that…

A: Sex and gender were once considered synonymous, but in today's world, many people identify with a…

Q: What role did the death of the dinosaurs play in primate evolution Please answer asap and type your…

A: Private server group of mammals with large body structure and complex brain as compared to other…

Q: Characteristics of Living Things DANDELION 1. Movement 2. Respiration (Cells) 3. Sensitivity…

A: * Dandelion is an short perennial plant thatt grows above soil and can withstand cold and tolerate…

Q: 1. The alternate form of a gene is A. Alternate type B. Recessive character C Dominant character D.…

A: Introduction Deoxyribonucleic acid (DNA) is a polymer made up of two polynucleotide chains that coil…

Q: Through the example of the H5N1 virus, explain how diseases are fast spreading due to globalization…

A: Introduction We will answer the question in below step

Q: e the presence of saliva

A: Saliva is a thick, colourless, opalescent fluid that is constantly present in the mouth of humans…

Q: Select the correct answer. Marcus is admitted to the hospital for a bone marrow stem cell transplant…

A: The cell division is the production of new daughter cells from the old mother cells. Usually in…

Q: Question 47 The proofreading of DNA is essential for faithful replication. A) True B) False

A: Proof reading of DNA is essential for maintaining a homogenous DNA across multiple cycles of…

Q: Why do you think the researchers removed the genes for the three carbohydrate antigens, pig growth…

A: Commonly used pig breeds in research include Duroc, Yorkshire, Landrace, and crossbreeds. Domestic…

Q: What type of DNA changes are there for c.316-106C>G mutation. Is it pathogenic?

A: This is showing a type of mutation in which cytosine has been converted into guanine. Cytosine is a…

Q: Question 43 The DNA strand that serves as a template during transcription is known (other than…

A: DNA transcription is the process by which the coded information from the genome is sent to the cell…

Q: The VPg protein from picornaviruses has which of the following function? O a. It packages the viral…

A: Picornaviruses are viruses that infect fishes, mammals, and birds. These group of viruses are…

Q: In terms of an electrochemical gradient being produced, compare and contrast any three (3) systems…

A: *An electrochemical gradient is an gradient of electrochemical potential  for ion which can move…

Q: What is mitosis? What is the importance of mitosis?

A: Cell division is the process by which a cell can divide itself into two cells. the process of cell…

Q: Question 14 Which of the following is NOT true regarding E. coli replication on the lagging strand?…

A: In case of E. Coli replication of lagging strand: The synthesis is discontinuous and occurs 5' to 3'…

Q: Question 1 Identify a FALSE statement from the following, O peptidoglycan in Gram negative wall is…

A: Question (1) Answer :-Correct option is (e) lipid A induces activated macrophage yo secret…

Q: A computer virus is capable of replicating itself.What other features of computer virus are similar…

A: Introduction A virus is a small piece of genetic material, such as DNA or RNA, encased in a protein…

Q: Match the description on the left side to the correct term from the choices on the right side.…

A: 51. -->   option M. 52.  -->  option B. 53. -->    option L. 54. -->   option J and K…

Q: Construct a comparative matrix on different sterilization methods.

A: In our enterprise groups, it’s vital to have an expansion of sterilization methods so that you can…

Q: What aminos acid would the anticodon GAC be translated into?

A: * DNA will have four nucleotides  Adenine Guanine Cytosine Thymine * RNA will have four…

Q: Following the 5-> 3' conversion of writing nucleotide sequence, indicate which of the following MRNA…

A:

Q: Fig. 7. Graphical representation of Species A and Species B in separate tanks Formulate two…

A: A hypothesis is a proposed explanation for observations made on the phenomenon. It can be the…

Q: The acquisition of memories can be demonstrated in rodents on a T-maze task. In this task, a food…

A: The task described the homeostasis and growth factor of mice . The innate and adaptive behaviour…

Q: need a good answer.with explanation.Thanks 1- Which of the following species appeared earliest in…

A: 1- Which of the following species appeared earliest in the fossil record? Choices ( Homo…

Q: Evolutionary Sciences ask: O "Why" questions O "What" questions "How" questions O "When" questions

A: The main function of evolutionary scientists is how the today's organisms evolved into the current…

Q: Question 7: How could immunotherapy be used to kill superbugs and how would this therapy distinguish…

A: The immune system checks the body for infections or problem-causing chemicals and fights any harmful…

Q: Which type of molecule binds at the core promoter sites in association with RNA polymerase? A…

A: RNA polymerase can attach to the polymer by only one method. This method involves binding of Basal.…

Q: Chapter 23- Diseases of the Digestive System Match the description on the left side to the correct…

A: INTRODUCTION Answer to the question 41-50 is given below.

Genomic studies

Genomic studies (genomics) is the study of the whole genome of an organism. Using bioinformatics and high-performance computing, genomic researchers examined massive amounts of deoxyribonucleic acid (DNA)-sequence data to discover variations or mutations that affect drug response, health, or disease. Genomics is a much younger discipline than genetics, having only emerged in the last few decades as a result of technological advancements in DNA sequencing and computational biology.