6 Following the 5-> 3' conversion of writing nucleotide sequence, indicate which of the following MRNA codons can berecognized by the TRNA anticodon ICG. (note: answer all possibilities)DA UGAQUESTION 1OB.CGUOC CGAOD UGCDE CGCQUESTION 3Anti-codon is defined as "transfer RNAS base-pair with MRNA codons at a three-base sequence on the RNA".O TrueO False

Name: 6 Following the 5-> 3' conversion of writing nucleotide sequence, indi
Uploaded: 2024-03-20T06:42:55.000Z
Channel: Bartleby
Description: 6 Following the 5-> 3' conversion of writing nucleotide sequence, indicate which of the following MRNA codons can berecognized by the TRNA anticodon ICG. (note: answer all possibilities)DA UGAQUESTION 1OB.CGUOC CGAOD UGCDE CGCQUESTION 3Anti-codon is

Answered: Image /qna-images/answer/f7d83022-15f5-4ead-85e1-a8effbb233a2.jpg

Science

Biology

Following the 5-> 3' conversion of writing nucleotide sequence, indicate which of the following MRNA codons can be recognized by the TRNA anticodon ICG. (note: answer all possibilities) DA UGA OB.CGU OC CGA ODUGC DE CGC QUESTION 3 Anti-codon is defined as "transfer RNAS base-pair with MRNA codons at a three-base sequence on the tRNA". O True O False

Following the 5-> 3' conversion of writing nucleotide sequence, indicate which of the following MRNA codons can be recognized by the TRNA anticodon ICG. (note: answer all possibilities) DA UGA OB.CGU OC CGA ODUGC DE CGC QUESTION 3 Anti-codon is defined as "transfer RNAS base-pair with MRNA codons at a three-base sequence on the tRNA". O True O False

Biochemistry

6th Edition

ISBN:9781305577206

Author:Reginald H. Garrett, Charles M. Grisham

Publisher:Reginald H. Garrett, Charles M. Grisham

Chapter28: Dna Metabolism: Replication, Recombination, And Repair

Section: Chapter Questions

Problem 20P: Figure 28.41 gives some examples of recombination in IgG codons 95 and 96, as specified by the Vkand...

See similar textbooks

Similar questions

Figure 28.41 gives some examples of recombination in IgG codons 95 and 96, as specified by the Vkand Jkgenes. List the codon possibilities and the amino acids encoded if recombination occurred in codon 97. Which of these possibilities is less desirable?
Consequences of the Wobble Hypothesis Point out why Cricks wobble hypothesis would allow fewer than 61 anticodons to be used to translate the 61 sense codons. How might wobble tend to accelerate the rate of translation?
Suppose the codon sequence GCCAUUCAAGCGGAU has a single base pair mutation to GCCAUUCAAACgGAU. If the old protein sequence was Ala-Ile-Gln-Ala-Asp, what will be the new sequence encoded by the mutant gene? _________(Use the 3-letter amino acid abbreviations with hyphens and no spaces in between, i.e. Ser-Asn-Tyr-Le
The 5′ sequence for the mRNA for E. coli ribosomal L10 protein is shownbelow. Identify the Shine–Dalgarno sequence and the initiator codon.5′¬CUACCAGGAGCAAAGCUAAUGGCUUUA¬3′
Using the following list of codons describe, using diagrams etc., how information stored in the DNA is translated into a peptide. Be sure to discuss all steps. In other words, use a diagram and give me sequences, transcription and translation steps. Show the sequences of the sense and the other DNA strand, the mRNA and the tRNA’s. UUU -phenylalanine UCU -serine AUG –initiation/methionine CUU -leucine ACU -threonine GUU -valine UAA -Termination
Indicate the amino acid sequence of the protein encoded by the following mRNA molecule. Use the genetic code table and assume that the very first “AUG” the ribosome encounters will serve as the start codon and specify methionine. 5’-AAUUCAUGCCCAAAUUUGGGGCACGAAGCUUCUUAGGCUAGUCCUAAAAAA-3’
What is the total size of the mature i.e. fully processed mRNA in nucleotides? How many amino acids would the encoded protein be? Assume that the N- terminal Met encoded by the AUG start codon, is NOT cleaved from the protein?
Referring to the genetic code presented in Figure , give the aminoacids specified by the following bacterial mRNA sequences. Q. 5′ –UUUGGAUUGAGUGAAACGAUGGAUGAAAG AUUUCUCGCUUGA–3′
What RNA base sequence is complimentary to the following DNA base sequence 5'-CATGATTAT-3'? Using the table of codons, give the primary structure of the protein coded for by the RNA sequence: 5’-CCA CGA GGG GAG ACU UAA-3’?
The genetic code consists of a series of three-base wordsthat each code for a given amino acid.(a) Using the selections from the genetic code shown below, de-termine the amino acid sequence coded by the following seg-ment of RNA: UCCACAGCCUAUAUGGCAAACUUGAAG AUG= methionine ;CCU= proline; CAU= histidine ;UGG= tryptophan AAG= lysine ; UAU= tyrosine ;GCC= alanine ;UUG= leucine ;CGG= arginine ;UGU= cysteine ;AAC =asparagine ;ACA=threonine ;UCC= serine ;GCA=alanine ;UCA=serine(b) What is the complementary DNA sequence from which this RNA sequence was made? (c) If you were sequencing the DNA fragment in part (b), how many complementary chain pieces would you obtain in the tube containing ddATP?
Given the following mRNA sequence: 5-AUCCCGUAUGCCCGGGAGCUAGCCCAGC-3 a) Label the first condon, the stop codon, the untranslated regions and predict the amino acid sequence of the polypeptid
The following segment of DNA in a hypothetical model organism encodes a polypeptide containingSEVEN amino acids. Pretend this short polypeptide is a completely functional enzyme. DNA tripletsencoding the translation initiation (or start) codon and a stop codon are included in the sequence.3 •GGGTACGATCGGAAAGTTGGTTCICCGGTATAGCTG5'5•CCCATGCTAGCCTTTCAACAAAGAGGCCATATCGAC.3'a. Label which of the DNA strands is the template strand and which is coding strand. b. Below, show sequence and the polarity of the mRNA encoded by this 'gene'. Determine theamino acid sequence of the polypeptide (use three letter codes for the amino acids) andidentify the N- and C- terminal ends of the polypeptide. please help. I am confused. c. Which of the 7 side chains in this polypeptide can form hydrogen bonds with polar molecules(like water)? Place a circle around these.d. Some amino acids on a polypeptide can be modified post-translationally. Thesemodifications may have some effect on the function of the…