Biochemistry
6th Edition
ISBN: 9781305577206
Author: Reginald H. Garrett, Charles M. Grisham
Publisher: Cengage Learning
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 29, Problem 2P
The Events in Transcription Initiation Describe the sequence of events involved in the initiation of transcription by E. coil RNA polymerase. Include in your description those features a gene must have for proper recognition and transcription by RNA poIymerase.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Please describe why regulationof transcription frequently involves the promoter and protein interactions with the promoter. Please add details about bacterial promoter properties to discuss RNA polymerase binding to initiate transcription.
The phosphorylation of the RNA polymerase II tail is important for the following EXCEPT
a.the formation of transcription initiation complex
b.RNA processing
c.the dissociation of most general transcription factors
d.initiation of transcription by RNA polymerase II
Describe the transcription initiation (on the example of mRNA synthesis by RNA polymerase II).
Chapter 29 Solutions
Biochemistry
Ch. 29 - Prob. 1PCh. 29 - The Events in Transcription Initiation Describe...Ch. 29 - Substrate Binding by RNA Polymerase RNA polymerase...Ch. 29 - Comparison of Prokaryotic and Eukaryotic...Ch. 29 - Prob. 5PCh. 29 - Prob. 6PCh. 29 - Prob. 7PCh. 29 - Alternative Splicing Possibilities Suppose exon 17...Ch. 29 - Prob. 9PCh. 29 - Prob. 10P
Ch. 29 - Post-transcriptional Modification of Eukaryotic...Ch. 29 - Prob. 12PCh. 29 - Prob. 13PCh. 29 - The Lariat Intermediate in RNA Splicing Draw the...Ch. 29 - Prob. 15PCh. 29 - Prob. 16PCh. 29 - Prob. 17PCh. 29 - Prob. 18PCh. 29 - Figure 29.15 highlights in red the DNA phosphate...Ch. 29 - Chromatin decompaction is a preliminary step in...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biochemistry and related others by exploring similar questions and additional content below.Similar questions
- Below is the DNA sequence of a patient with overlapping genes (a single mRNA has multiple initiation points for translation) for two different proteins (DADαs and AMA): 5’- GTCCCAACCATGCCCACCGATCTTCCGCCTGCTTCTGAAGATGCGGGCCCAGGGAAATCTCTAACG-3’ 1. Indicate the DNA sequence coding for RNA. 2. Indicate the amino acid sequence of each of them.arrow_forwardThe transcription initiation factor “recruited” together with RNA-Pol II in the formation of preinitiation complex is A. TFIIB B. TFIIH C. TFIIF D. TFIIAarrow_forwardThe following DNA nucleotides are found near the end of a bacterial transcription unit. 3′–AGCATACAGCAGACCGTTGGTCTGAAAAAAGCATACA–5′ a. Mark the point at which transcription will terminate. b. Is this terminator rho independent or rho dependent? c. Draw a diagram of the RNA that will be transcribed from this DNA, including its nucleotide sequence and any secondary structures that form.arrow_forward
- The basic of transcription include nucleosome remolding, pre-initiation, initiation, promoter clearance and elongation and termination. Describe these steps into detail including basic machinery involved, enzymatic activities and potential aberrancies that increase or decrease gene transcriptionarrow_forwardDescribe the recognition process by whichthe tRNA for N-formylmethionine interacts with the portion ofmRNA that specifies the start of transcription.arrow_forwardDescribe the initiation step of bacterial transcription (make sure to include important enzymes, parts, and sequences in your answer) up to the beginning of elongation. What are three ways that transcription differs between bacteria and eukaryotes? (I'm not looking for types of RNA modification, just in terms of transcription)arrow_forward
- Transcription in eukaryotes requires which of the following in addition to RNA polymerase? Choose all that apply A) ribsomes and tRNAs B) start and stop codons C) several transcription factors D) DNA nucleotides E) Aminoacyl-tRNA synthetase F) RNA nucleotides .arrow_forwardThe following DNA nucleotides are found near the end of a bacterial transcription unit. 3′–AGCATACAGCAGACCGTTGGTCTGAAAAAAGCATACA–5′ Q. Mark the point at which transcription will terminatearrow_forwardHow does the 4 feature of transcription factors namely the structural motifs of DNA binding protein, activation domains, multiple transcription factors and enhancers help in the design of a building block tool. U can use the SrY gene as ur building block tool. Pls explain in details using those features of the transcription factors. In 400 wordsarrow_forward
- Once an RNA polymerase has initiated transcription, it will release the sigma factor or sigma subunit and bind other proteins known as elongation factors before it begins moving down the DNA template doing strand elongation. Briefly explain why this is necessary - why can't RNA polymerase + sigma factor do all of transcription? Be specific.arrow_forwardWithin a promoter, a transcriptional start site isa. located at the –35 sequence and is recognized by σ factor.b. located at the –35 sequence and is where the first base is used as atemplate for RNA transcription.c. located at the +1 site and is recognized by σ factor.d. located at the +1 site and is where the first base is used as a templatefor RNA transcription.arrow_forwardArrange the processes involved from Transcription to Translation. RNA polymerase binds in the promoter regions Polypeptide cleavage Release of methionine and conversion to active protein Translocation Appearance of UAG codon Attachment of the mRNA to ribosome with AUG in the P site DNA rejoins Covalent bonding of AA to the tRNA Elongation of RNA transcript Binding of Rho factor Partial unwinding of DNAarrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
BiochemistryBiochemistryISBN:9781305577206Author:Reginald H. Garrett, Charles M. GrishamPublisher:Cengage Learning
Biochemistry
Biochemistry
ISBN:9781305577206
Author:Reginald H. Garrett, Charles M. Grisham
Publisher:Cengage Learning
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY