Answered: Predict how the mutation in the seventh…

Name: Predict how the mutation in the seventh codon of normal hemoglobin cha
Uploaded: 2024-03-20T06:42:55.000Z
Channel: Bartleby
Description: Predict how the mutation in the seventh codon of normal hemoglobin changing it from ctc to act, would it affect the protein being synthesized?

Science

Biology

Predict how the mutation in the seventh codon of normal hemoglobin changing it from ctc to act, would it affect the protein being synthesized?

Biology (MindTap Course List)

11th Edition

ISBN:9781337392938

Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg

Publisher:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg

Chapter13: Gene Expression

Section13.5: Mutations

Problem 12LO: Give examples of the different classes of mutations that affect the base sequence of DNA in protein...

See similar textbooks

Similar questions

Refer to the genetic code in Figure 15.10 to answer the following question Q. If a single transition occurs in a codon that specifies Leu, what amino acids can be specified by the mutated sequence?
Which statements decribe the function of the protein encoded by this gene CAGATTGTGAAGAGGTCTCTTGA? A. Break point cluster region protein that may function as a GTPase B. A coagulation factor C. An enzyme involved in the breakdown of glycosaminoglycans (GAGs) D. Transcription factor involved in the DNA damage response E. A component of hemoglobin F. A tyrosine kinase G. Serine/threonine kinase involved in the DNA damage response H. A tumor suppressor involved in WNT signalling I. A DNA repair enzyme involved in nucleotide excision repair
tRNAs a. carry amino acids b. bind to the anticodon present in the mRNA c. adapt the genetic information to the ribosome d. catalyze the peptide bond
Refer to the genetic code in Figure 15.10 to answer the following question Q. If a single transversion occurs in a codon that specifies Leu, what amino acids can be specified by the mutated sequence?
Describe how the sequence of nucleotides in mRNA codes for the amino acids of a protein. How can the insertion or deletion of even one nucleotide in mRNA cause significant changes to the protein that results?
Predict the sequence of amino acid coded by the mrna sequence 5’ GGA-GGC-ACA-UGG- GAA 3’
A cell has a defective enzyme that attaches the alanine amino acid (Ala), instead of a valine amino acid (Val), to tRNAs with the anticodon CAA. Will any polypeptides in the cell contain valine? Why or why not?
Give examples of the different classes of mutations that affect the base sequence of DNA in protein encoding genes and explain the effects that each has on the polypeptide produced.
The first successful drug trial to reduce concentrations of huntingtin in the brain used single stranded DNA molecules. Suggest and explain how this drug could cause a reduction in the concentration of the protein huntingtin.
Suppose that a gene underwent a mutation that changed a GAA codon to UAA. (a) Name the amino acid encoded by the original triplet. (b) Identify a tRNA anticodon that could translate the nonsense UAA triplet. (c) What other amino acid could be encoded by the mutant tRNA?
Refer to the genetic code in Figure 15.10 to answer the following question Q. If a single transition occurs in a codon that specifies Phe, what amino acids can be specified by the mutated sequence?
What might be the result of a mutation of DNA in which a triplet code such as UAC now says UAA in the middle of a protein? Could this cause problems? Might we see these problems in nature? Speculate as to an