The formation of peptide bonds between amino acids occurs _____. a. during transcription b. during the elongation step to translation c. during the assemble of the ribosome and mRNA d. while DNA is being replicated

The formation of peptide bonds between amino acids occurs _____. a. during transcription b. during the elongation step to translation c. during the assemble of the ribosome and mRNA d. while DNA is being replicated

Name: The formation of peptide bonds between amino acids occurs _____.a. dur
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: The formation of peptide bonds between amino acids occurs _____.a. during transcription b. during the elongation step to translationc. during the assemble of the ribosome and mRNAd. while DNA is being replicated

BIOLOGY:CONCEPTS+APPL.(LOOSELEAF)

10th Edition

ISBN:9781305967359

Author:STARR

Publisher:STARR

Chapter9: From Dna To Protein

Section: Chapter Questions

Problem 14SA: Energy that drives translation is provided mainly by ______ . a. ATP c. GTP b. amino acids d....

See similar textbooks

Similar questions

Once translated into proteins: (a) How many nucleotides are there? (b) How many codons are there? (c) How many amino acids?
Transcription & Translation A. Describe mRNA splicing. B.How do mRNA and rRNA interact? C.How do mRNA and tRNA interact?
DNA is the cellular repository of genetic information, andproteins are synthesized from RNA transcripts. Why don’tcells simply skip the transcription step and use DNA directlyin protein synthesis?
At what point in gene expression do you think the process could be regulated? Select all that apply: a) Before transcription begins. b) During the process of transcription. c) During the process of translation. d) After translation ends.
Given the following DNA sequence: ATCGGATCCGGTTAACTATTTAAAGCA a. predict the compliment strand of dna (coding strand) b. predict the transcribed product of the coding strand (mRNA transcript) c. given the genetic code table, predict the amino acid sequence of the transcript d. predict the amino acid sequence if the A underlined became deleted
Considering the given sequence of nucleotides in an mRNA molecule, (a) what is the sequence of the DNA template strand from which the RNA was synthesized? (b) What peptide is synthesized by this mRNA sequence? 5' GAG CCC GUA UAC GCC ACG 3'
A segment of DNA has the followimg sequence of bases.. 5'-ATGCAATGATATTGAAGCTTA-3' a) What sequence of bases would appear in mRNA transcribed from this segment? b) Assume the first base in this mRNA is the beginning of a codon. What order of amino acid would be translated into a polypeptide synthesized along this segment? c) Give anticodons for each tRNA associated with the translation in part (b)
A single template strand of a DNA molecule is represented by 3’atgtaccatgcgcaaatttaaaggccc5’. a) Using the same strand above as a template, write the pre-mRNA transcript. b) List the molecules that must be present for DNA to be transcribed. Briefly describe their function. c) What are three modifications that happen to pre-mRNA before it becomes mature mRNA
Energy that drives translation is provided mainly by ______ . a. ATP c. GTP b. amino acids d. ribosomes
_______ are removed from new mRNAs. a. Introns c. Poly-A tails b. Exons d. Amino acids
In bacterial cells, translation can begin before transcription of a gene is complete. Can this happen in our cells? Why or why not?
If a eukaryotic mRNA has failed to have a cap attached to its 5' end, what would the negative consequence(s) be? I chose b and got this questions wrong, why is this wrong? a. The mRNA would not properly exit the nucleus. b. The mRNA would not properly bind to a ribosome. c. The mRNA would not receive a poly A tail. d. The mRNA would not use the correct start codon. e. Both a and b are correct.