A particular tRNA is mutated so that the amino acid attachment cannot bind with the aminoacyl-tRNA synthase. What happens when an MRNA transcript contains the codon for this tRNA? O A. The tRNA will not bind to this codon. O B. Translation stops and the protein is released. O C. The wrong tRNA is added to the protein chain. O D. Translation stops and the protein remains bound to the ribosome.

A particular tRNA is mutated so that the amino acid attachment cannot bind with the aminoacyl-tRNA synthase. What happens when an MRNA transcript contains the codon for this tRNA? O A. The tRNA will not bind to this codon. O B. Translation stops and the protein is released. O C. The wrong tRNA is added to the protein chain. O D. Translation stops and the protein remains bound to the ribosome.

Name: A particular tRNA is mutated so that the amino acid attachment cannot
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: A particular tRNA is mutated so that the amino acid attachment cannot bind with the aminoacyl-tRNAsynthase. What happens when an mRNA transcript contains the codon for this TRNA?O A. The tRNA will not bind to this codon.O B. Translation stops and th

Concepts of Biology

1st Edition

ISBN:9781938168116

Author:Samantha Fowler, Rebecca Roush, James Wise

Publisher:Samantha Fowler, Rebecca Roush, James Wise

Chapter9: Molecular Biology

Section: Chapter Questions

Problem 6RQ: A promoter is ______. a. a specific sequence of DNA nucleotides b. a specific sequence of RNA...

See similar textbooks

Similar questions

In the chain elongation of proteins, the new aminoacyl-tRNA bonds to? a.A site b.E site c.G site d.P site
Which statement is true of the translocation phase of elongation during protein synthesis? a. The empty tRNA moves to the A site of the ribosomal complex. b. The empty tRNA moves to the T site of the ribosomal complex. c. The dipeptide moves from the A site to the P site of the ribosomal complex. d. The dipeptide moves from the P site to the A site of the ribosomal complex.
Which of the following best describes tRNA? a. Provides the instructions for the amino acid sequence of a polypeptide b. Complexes with ribosomal proteins to form ribosomes c. Used for eukaryotic RNA processing d. Transports amino acids to ribosomes during translation
Use the table to answer: A portion of an mRNA attached to a ribosome reads: 5′ GACCAUUUUGACAAAGUUGUAGUGUGGGUAGGGUGA 3′ If a tRNA with a Phe attached is in the P site of the ribosome, an uncharged tRNA will be present in the E site that delivered which amino acid? What is the last amino acid in this polypeptide? Which amino acid will be the most frequent in the polypeptide?
The codon UUU in an mRNA molecule which results in phenylalanine being inserted as the protein is made. Which will be a characteristic of this codon? a. The tRNA molecule that binds to the UUU codon must have an AAA anticodon. Nde ba e2? b. UUU could code for both phenylalanine and alanine during translation. c. The aminoacyl-tRNA synthetase for phenylalanine binds only the UUU codon. d. UUU is probably only one of several codons that code for phenylalanine.
Where does mRNA/tRNA codon-anticodon recognition take place? a)40S b)50S c)The surface between the two ribosomal subunits d)30S
An anticodon of tRNA has the sequence GCA. What amino acid does this tRNA carry? HINT: you use mRNA codons to read the genetic code chart.
The ribosome is needed for translation of mRNA (a) because it has the enzyme for adding amino acids to the 5’ end of a tRNA (b) because the ribosomal RNA contains the codon which determines the sequence of amino acids in a protein (c) because it positions tRNA and mRNA so that correct pairing of codon and anti-codon can occur (d) because it has an enzyme that removes introns from mRNA (e) all of the above
Which statement BEST DESCRIBES the tRNA structure? A. Amino acids bind to the 5′ end of the tRNA molecule. B. When a tRNA has an amino acid attached to it, it is considered to be a charged tRNA C. Synthetases are not important to tRNA D. Amino acids are linked to tRNAs with hydrogen bonds
After the ribosome slides along the mRNA, the dipeptide will be attached to the tRNA in the ________ site?
The anticodon of a particular tRNA molecule is(A) complementary to the corresponding mRNA codon.(B) complementary to the corresponding triplet in rRNA.(C) the part of tRNA that bonds to a specific amino acid.(D) catalytic, making the tRNA a ribozyme.
What process is the P site in a ribosome most closely associated with? a. Binds the tRNA molecule carrying the next needed amino acid to the mRNA strand b. Transcription of DNA to RNA c. Release of a tRNA molecule from a ribosome d. Anchoring of the tRNA holding the growing polypeptide