Answered: Q1. Considering how readily RNA folds…

Name: 1,2 Q1. Considering how readily RNA folds to form secondary structure,
Uploaded: 2024-03-20T06:42:55.000Z
Channel: Bartleby
Description: 1,2 Q1. Considering how readily RNA folds to form secondary structure, why isn't it used tostore genetic information rather than DNA?A1.Q2. Do miRNA and siRNA both derive from the same source? Explain.A2.

Science

Biology

Q1. Considering how readily RNA folds to form secondary structure, why isn't it used to store genetic information rather than DNA? Al.

Biology 2e

2nd Edition

ISBN:9781947172517

Author:Matthew Douglas, Jung Choi, Mary Ann Clark

Publisher:Matthew Douglas, Jung Choi, Mary Ann Clark

Chapter16: Gene Expression

Section: Chapter Questions

Problem 17RQ: An unprocessed pre-mRNA has the following structure. Which of the following is not a possible size...

See similar textbooks

Similar questions

A scientist sequencing itiRNA identifies the following strand: CUAUGUGUCGUAACAGCCGAUGACCCG What is the sequence of the amino acid chain this itiRNA makes when it is translated?
Consider this short mRNA: 5’ – AUGGCAGUGCAA – 3’. Answer the following questions assuming the code is non-overlapping. How many codons are represented in this oligonucleotide? If the second G were changed to a C, what would be the resulting amino acid?
Give only typing answer with explanation and conclusion 12. RNA transcripts can be modified in several ways: processing, splicing, 5’ capping, 3’ poly A tailing and RNA editing. Why are those processes important? Make sure you are able to explain how each mechanism occurs.
2a) Suppose you have a gene in which a single base substitution has created the nonsense mutation 5'TAA3' (which will be transcribed into 5'UAA3' in the mRNA - but recall that mutations are changes in the DNA sequence). Name all the amino acids that could have been coded for by the original, unmutated codon at that position in the gene.
Which is the odd one out ? explain how the rest are related nucleoid cytoplasm RNA-binding protein tRNA mRNA rRNA miRNA
1) Considering how readily RNA folds to form a secondary structure, why isn’t it used to store genetic information rather than double-stranded DNA? Cite multiple reasons. 2) Do miRNA and siRNA both derive from the same source? Explain.
Give typing answer with explanation and conclusion 5. The following diagram represents DNA that is part of the RNA coding sequence of a transcription unit. The bottom strand is the template strand. Give the sequence found on the RNA molecule transcribed from this DNA & identify the 5ʹ and 3ʹ ends of the RNA. 5′–ATAGGCGATGCCA–3′ 3′–TATCCGCTACGGT–5′ ← Template strand
0. Explain how differences in the initiation of translationdictate that eukaryotic mRNAs are monocistronicwhile prokaryotic mRNAs may be polycistronic.
How would the deletion of the following sequences or features most likely affect a eukaryotic pre-mRNA? Q. 5′ cap
1. a. CRISPR-Cas9 is a valuable biotechnology tool. Explain how this system uses RNA and the result of the interaction. b. How is this different from miRNA?
: (2) (a) Using the codon table, show the consequences of adenine base addition to thebeginning of the following coding sequence on the subsequent translation. CGA-UCG-GAA-CCA-CGU-GAU-AAG-CAU asap
5’ UGG CAA UCC UAC GAU 3’ Write out the sequence of the anticodon in the tRNA that would bind to the fourth codon in the mRNA. 2. Write out a possible miRNA that could regulate the expression of this gene