Question 1 Being able to associate a QTL with a marker relies on linkage. Suppose researchers genotype a population for two marker loci that they think are on the same chromosome. Using these two markers they notice that out of 1,000 genotypes, there were 53 recombinant individuals. a) Make a conservative estimate of how far apart the two loci are. b) Presuming these are mammals, how many DNA bases does this distance represent?

Question 1 Being able to associate a QTL with a marker relies on linkage. Suppose researchers genotype a population for two marker loci that they think are on the same chromosome. Using these two markers they notice that out of 1,000 genotypes, there were 53 recombinant individuals. a) Make a conservative estimate of how far apart the two loci are. b) Presuming these are mammals, how many DNA bases does this distance represent?

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter14: Biotechnology And Society

Section: Chapter Questions

Problem 1CS: Can DNA profiling identify the source of a sample with absolute certainty? Because any two human...

See similar textbooks

Similar questions

Suppose you are constructing a human genomic library in BAC vectors where the human DNA fragments are on average 100,000 bp. a. What is the minimum number of different recombinant BACs you need to construct in order to havea greater than zero chance of having a completelibrary—meaning one in which the entire genomeis represented?The simple statistical equation that follows allows youto determine the size that a genomic library needs tobe (that is, the number of independent recombinantclones you need to make) for a given likelihood thatthe entire genome is represented in the library.N = ln (1 − P)ln (1 − f )In the equation, N is the number of independent recombinant clones; P is the probability that any particular partof the genome is represented at least one time; f is thefraction of the genome in a single recombinant clone.(Note: ln is the natural log, sometimes written as loge.)b. Calculate f for the genomic library described in part (a).c. How many different recombinant BAC…
With the information that a Wright- Fisher population have a size of 10,000 and assume that mutation rate is 2.5x10-8 per site per generation. What is the probability of difference between the two sequences that were randomly taken from the population? Show all working and explanation.
How could you explain the variable DNA concentrations obtained between the different student samples 1-4 in the table above? 2.Which student sample(s) potentially contained proteins, explain how you deduced this from the result? How could you explain the variable DNA concentrations obtained between the different student samples 1-4 in the table above? 2.Which student sample(s) potentially contained proteins, explain how you deduced this from the result?
In Figure 7-7, do you recognize any of the componentsused to make Watson and Crick’s DNA model? Wherehave you seen them before?
Among all these primer pairs from Primer-Blast, which is the best to use for a PCR reaction and why?
Shown below are several next-generation sequencing reads from a sample you have. Which of the following is the most likely candidate for the original linear piece of DNA present in the sample that created the sequence reads shown below? 5' GGGCATTA 3' 5' TACGAACA 3' 5' ATACCGGGC 3' 5' ACCGTACG 3' 5' AACATACC 3' Question 4 options: 5' ATTAACCGTACGAACATACCGGGC 3' 5' GGGCATTATACGAACAATACCGGGC 3' 5' ACCGGGCATTAACCGTACGAACAT 3' 5' AACATACCGGGCATTAACCGTACG 3' 5' GGCATTAACCGTACGAACATACCG 3' 5' ACCGTACGAACATACCGGGCATTA 3'
Question:- for a single locus how many dna bands will any given person have?
Based on one strand of a certain segment of DNA with the sequence below, answer the following question: 3'-ATGGATCCCATC-5' a. Is the formula "genotype + environment=phenotype" accurate?
A short micrococcal nuclease digestion yielded DNA fractions of 700, 1400, and 2100 bp. Predict what these fractions represent. What conclusions can be drawn?
What possible errors can a BLAST search make when assessing gene function to determine practical and evolutionary associations?
What does it mean if the closest matched organism that is returned from a BLAST search is less than a 97% match to an organism you are sequencing?
DNA fingerprinting questions: ( Please label each lane so I know which one you refer to) Please explain vividly so I can understand: •Explain each lane, by analyzing the band pattern and concluding whether it's homozygous or heterozygous for the presence of Alu at the PV92 locus. •Literature states Alu insertions at PV92 locus are most common in the Asian population (+/+) and mostly not found in Europeans, Americans (-/-) Reference: https://www.mediafire.com/file/s3nr36ow4bw4udw/DNA+Fingerprinting.docx/file