Question 2. You want your recombinant Human Growth Hormone to be tagged at the N-terminus with a poly- histidine domain (which is present in the vector), so you need your to cloned in a way that maintains the reading frame. To facilitate cloning, you have added an EcoR1 restriction site to the N-terminus of the Human growth hormone, as an EcoR1 site is also present in the vector (EcoR1 sites in red; N-terminus of HGH in blue). Vector 1: Vector 2: Vector 3: i) Answer: ii) His His His His His His Gly Asn Ser Gly Gln CAT CAT CAT CAT CAT CAT GGG AAT TCG GGC CAA DNA to be inserted into the vector: Answer: His His His His His His Glu Phe Gly Pro Lys CAT CAT CAT CAT CAT CAT GAA TTC GGG CCC AAA His His His His His His Gly Ile Arg Ala Gln CAT CAT CAT CAT CAT CAT GGA ATT CGG GCC CAA Which vector will you use, 1, 2, or 3? Met Ala Thr Gly... AACAAGAATTCTATG GCT ACA GGG... Draw the final DNA (bottom) and tagged protein (top) sequences after you have ligated the insert to the proper vector

Question 2. You want your recombinant Human Growth Hormone to be tagged at the N-terminus with a poly- histidine domain (which is present in the vector), so you need your to cloned in a way that maintains the reading frame. To facilitate cloning, you have added an EcoR1 restriction site to the N-terminus of the Human growth hormone, as an EcoR1 site is also present in the vector (EcoR1 sites in red; N-terminus of HGH in blue). Vector 1: Vector 2: Vector 3: i) Answer: ii) His His His His His His Gly Asn Ser Gly Gln CAT CAT CAT CAT CAT CAT GGG AAT TCG GGC CAA DNA to be inserted into the vector: Answer: His His His His His His Glu Phe Gly Pro Lys CAT CAT CAT CAT CAT CAT GAA TTC GGG CCC AAA His His His His His His Gly Ile Arg Ala Gln CAT CAT CAT CAT CAT CAT GGA ATT CGG GCC CAA Which vector will you use, 1, 2, or 3? Met Ala Thr Gly... AACAAGAATTCTATG GCT ACA GGG... Draw the final DNA (bottom) and tagged protein (top) sequences after you have ligated the insert to the proper vector

Biology 2e

2nd Edition

ISBN:9781947172517

Author:Matthew Douglas, Jung Choi, Mary Ann Clark

Publisher:Matthew Douglas, Jung Choi, Mary Ann Clark

Chapter14: Dna Structure And Function

Section: Chapter Questions

Problem 34CTQ: Quinolone antibiotics treat bacterial infections by blocking the activity of topoisomerase. Why does...

See similar textbooks

Similar questions

QUESTION 1 The sequence of a DNA including the gene that you want to clone into a plasmid vector. The gene of interest is in bold with the stop codon shown in green. The sequence has no suitable restriction site for digestion to isolate the gene fragment for cloning. Recognition site of Sal-I enzyme is given below. Design a primer to introduce the Sal-I site to the beginning of the gene. Write the complementary DNA sequence Design the primer and show which strand of DNA it is complementary to Mark the direction of all DNA sequences including the primer. 5-TGTCAGCACCATCTGTCCGGTCCCAGCATGCCTTCTGAGACCCAGGCAG(1500b)TGGGGCTGACTCTTTA-3 Sal-1 recognition site GTCGAC CAGCTG THIS IS COMPLETE QUESTION. PLEASE EXPLAIN EACH PART OF GTHE QUESTION.
Question 9 Both conservative and replicative transposition result in movement of the transposon; however, only conservative transcription Group of answer choices A. Transfers the transposition to the new location without copying it B. Has transposase that cuts at inverted repeats and target sequences C. Produces a second copy of the transposon sequence D. Inserts the transposon sequence into target sequences
Question 1. Although we will not be doing a gel electrophoresis, data from a gel digest of a Bacillus anthrax plasmid is provided so you can do a DNA map. The Bacillus anthrax plasmid is 4000bp (4Kb) long. Note the origin position as well as the reference molecular weight markers on the gel. Two restriction enzymes, A and B, were used to obtain two individual digests, A and B. They were combined to produce the third digest. The restriction enzyme fragment pattern for the digest of Bacillus anthrax plasmid Determining the Number of Fragments How many fragments were produced by enzyme A? How many fragments were produced by enzyme B? How many fragments were produced by the combined digest (A and B)? Fragment Size Fragment size is relative to molecular weight, and must be determined by comparing the fragment distance to the molecular weight markers. The fragment size has been provided on the gel pattern for this exercise. To make a map you must determine the relative positions of the…
Question 1. Suppose that the diagram below represents the genomic organization of an enzyme involved in eye pigment production in mice. Within the gene are four exons. Biochemical analysis has revealed that the active site of the enzyme is located in the C terminus of the protein. The nucleotide length of each exon and intron is shown. The dinucleotide sequence GT represents the 5’ splice site and the dinucleotide sequence AG represents the 3’ splice site. Both the 5’ and the 3’ splice sites must be present for splicing to occur. Assume that the first and second stop codons are located immediately after the first and second 5’ splice sites, respectively; the third and fourth stop codons are located near the 3’ end of exons 3 and 4, respectively; all these stop codons are in the correct reading frame. E) Suppose you isolate a mutant mouse that has white eyes. When you examine the size of the eye pigment enzyme produced by this mouse, you see that it is 400 amino acids long. Sequence…
Question:- Viral vectors are not the only method being studied for gene therapy purposes. Which of the following is a nonviral delivery method for gene therapy? a.gene pills b.DNA bound to the surface of liposomes c.electrically stimulating cells to take up DNA d.DNA covered with protein
QUESTION NO. 1 Base excision repair A. is used only for bases that have been deaminated. B. uses enzymes called DNA glycosylases to generate an abasic sugar site. C. removes about 10 to 15 nucleotides. D. does not require an endonuclease. E. recognizes a bulky lesion. QUESTION NO. 2 Termination of a prokaryotic transcriptA. is a random process. B. requires the presence of the rho subunit of the holoenzyme. C. does not require rho factor if the end of the gene contains a G-C rich palindrome. D. is most efficient if there is an A-T-rich segment at the end of the gene. E. requires an ATPase in addition to rho factor. QUESTION NO. 3 Eukaryotic transcription A. is independent of the presence of upstream consensus sequences. B. may involve a promoter located within the region transcribed rather than upstream. C. requires a separate promoter region for each of the three ribosomal RNAs transcribed. D. requires that…
Question. Rewrite the following sentences after correction. (Subject: Biotechnology) The variation in the length of tandem repeat of microsatellite DNA has serious translational affects as this is due to its coding region. Correct: If one parent has sickle cell anemia and other has carrier genotype than there is 25 % chance that any offspring is carrier. Correct: Sickled WBC block the flow of blood and Calcium as they stick together and caused by frame shift mutation. Correct: The N1303K mutation in the CFTR gene of CF patients is autosomal dominant disorder due to insertion of asparagine at 1303. Correct: If a person RBCs have B surface antigen and it will clump with antigen B such clumping indicates Blood type B. Correct: Indirect ELISA can detect polygenic gene expression. Correct:
Question 1 a) What are the key modifications to the PCR primers, SHFw1 and SHRv1 in order for you to clone the PCR amplified Sonic Hedgehog into the multiple cloning site (MCS) of pSELECT-CGFP-blasti. Explain your answer in detail b) After you have successfully cloned Sonic Hedgehog into pSELECT-CCFP-blasti and transfected HEK 293 cells (human embryogenic kidney cells), you observed, using confocal microscopy that the GFP fluorescence displays a reticulate network pattern in the cytoplasm of the cells. Describe an approach you can use to determine the subcellular localization of the Sonic Hedgehog-GFP fusion protein.
Question 1 options: The specificity pocket of the serine protease chymotrypsin, which interacts with Tyr and Phe-containing peptide sequences, contains a Ser residue. A research group is trying to modify chymotrypsin such that it has a low KM with Trp-containing peptides. Enter the name or abbreviation of an amino acid that the Ser could be mutated to that would likely have the desired effect. (Hint: look at the diagrams of the specificity pockets shown in the course slides, and consider how the Ser would need to change to account for the difference between Tyr/Phe and Trp.)
Question 14 A large RNA–protein complex responsible for RNA splicing is called: Question 14 options: Spliceosome Splicing complex Exon-intron processor Transcription complex Question 15 Shortly after transcriptional initiation by RNA polymerase II, a methylated nucleoside (7-methylguanosine, m7G) is added and linked by a 5′–5′ phosphodiester bond to the first 5′ nucleotide, What is this process called? Question 15 options: 3' Capping 5' Capping Polyadenylation Splicing Question 16 During polyadenylation, the RNA is cleaved at a specific site. The site is: Question 16 options: 15–30 nucleotides downstream of the AAUAAA sequence 15–30 nucleotides upstream of the AAUAAA sequence at AAUAA sequence At…
Topic is central dogma of molecular biology Question: 4. Assuming the translation product is an enzyme, explain its role in the final expression of a phenotype. Please explain it to me thank you
QUESTION 9 These are enzymes that untwist the double helix at the replication forks of replicating DNA. Helicases Stingle-strand binding proteins Topoisomerase Telomerase