Q: Direction: On the worksheet, all the DNA sequences run from 3' to 5'. Supply the corresponding amino…
A: 3' TAC TCC GGC TCT CCC AGT TGA ACT 5' The sequence given is 3' to 5' sequence. Let us transcribe it…
Q: Briefly explain the importance of the protein factor EF-Ts in the translation process. Do not simply…
A: After the process of transcription of DNA to RNA in the nucleus of the cell, ribosomes in the…
Q: RNA Transcription, Translation, and Mutation Worksheet First, here is a strand of DNA, This strand…
A: Transcription is the process of transforming the information of DNA sequences in to the mRNA strand.
Q: Examine the following mRNA transcripts: Wild type: 5' CACUGAUGCACGGAUCAU 3' Mutant: 5'…
A:
Q: EF-Ts factor regenerates EF-Tu/GDP from EF-Tu/GTP for the next round of elongation cycle in…
A: Introduction The Central Dogma states the formation of RNA from DNA and proteins from RNA. The…
Q: Met-enkephalin (Tyr–Gly–Gly–Phe–Met) is a painkiller and sedative (Section 21.5). What is a possible…
A: Metenkefalin could be an artificial kind of the naturally occurring, endogenous opioid amide,…
Q: Direction: On the worksheet, all the DNA sequences run from 3' to 5'. Supply the corresponding amino…
A: “Since you have asked multiple questions, we will solve the first question for you. If you want any…
Q: Transcriplioh nie For cuch of the following sequences, fill in either the DNA, the mRNA sequence,…
A: Synthesis of m RNA Sandhya and RNA transcription and synthesis of amino acids linked together by…
Q: In describing the triplet binding assay, an undergraduate with limited knowledge of translation…
A: Every three nucleotides in a row count as a triplet in the genetic code and codes for a single amino…
Q: Briefly explain the importance of the 5'-cap in the translation process. Do not simply define the…
A: Introduction :- During transcription, the 5' cap is inserted to the first nucleotide in the…
Q: Choose the effect of the given agents to translation or transcription. CHOICES: prevention of…
A: DNA is important for the survival of an organism it is responsible for all phenotypes expressed by…
Q: RNA sequence of A gene If we have the following mutations, find the type of the mutation…
A:
Q: m
A: DNA → RNA RNA → protein
Q: Codon in Codon in Amino Acid DNA template strand MRNA APP gene in individuals 3'-CAA-5' 5'-GUU-3'…
A: Alzheimer's disease causes the brain's atrophy to shrink and the cells of the brain to die. Dementia…
Q: True or false?: The CTD is responsible for mRNA-processing steps that are specific for mRNA and not…
A: BASIC INFORMATION TRANSCRIPTION It is responsible for the formation of hnRNA which has the codes…
Q: Problem B. DNA: Codon Segmenting The way that DNA is often interpreted as genes is in groups of…
A: An open reading frame (ORF) is the segment of DNA (deoxyribonucleic acid) sequence that can be…
Q: Choose one of the strands and transcribe the strand. Show the steps (with proper label) and do a…
A: The process of gene expression involves the process of transcription followed by the process of…
Q: If the nonsense mutation is in the last exon of the mRNA, the result would be: nonsense-mediated…
A: A mutation is a permanent change in the DNA of a cell such that the sequence deviates from what is…
Q: Type of Point Frameshift mutation Substitution Insertion or Deletion 10 (Circle one.) How did the…
A: Nucleus is chief controller of cell in which genetic information is safely stored . It exhibit long…
Q: Ôn the space provided, type the translation product of wild-type gene A (use three- letter…
A:
Q: The template strand of wild- type gene A is shown below. On the space provided, type the translation…
A:
Q: The code for a fully functional protein is actually coming from an mRNA transcript that has…
A: The process of synthesis of proteins from mRNA is called as translation while the process of…
Q: Matching type. Match column A with column B. Your answer in column B should be matched with column…
A: Molecular biology has become the most recent tool added to the study of genetics. It provides…
Q: The first 15 bases of the original coding informational strand of DNA (which continues after what is…
A: Mutation can be divided into several categories. The types of mutation include missense mutation,…
Q: Which statements are true? Explain why or why not.1 The consequences of errors in transcription…
A: Note: As Per Guidelines, We Can Answer One Question At A Time. Ask Again To get rest answers.…
Q: rmal hemoglobin is created from the codon GAA, which codes for glutamic d while sickle-cell…
A: Any abrupt change in the DNA sequence of nucleotides results in mutation its effects may be diverse…
Q: Briefly outline the similarities and the differences you expect to see between prokaryotic and…
A: The translation is a process through which polypeptides are synthesized. It is the final step of…
Q: List the differences in the loading of the tRNA and its alignment with the mRNA between the…
A: Translation It is defined as the process of translating the sequence of mRNA molecules to the…
Q: DNA Double А A Helix C T C C MRNA A C C C Transcribed TRNA A Anticodon Amino Acid Pro Sequence Amino…
A: DNA has sense and antisense sequence, sense codons have the same bases as that of mRNA except that…
Q: Translational control is usually aimed at preventing the initiation of translation. With regard to…
A: The process of translating the sequence of mRNA into an amino acid sequence is called translation.…
Q: Transcribe the following DNA sequence. Then translate the resulting mRNA transcript.…
A: Mutation is any change in the DNA sequence. It can alter the protein sequence because the proteins…
Q: Assume that the translational error frequency, δ, is 1 x 10–4.(a) Calculate the probability of…
A: mRNAs are used to form protein by translation. The translation is performed using ribosomes, t-RNA…
Q: Mutated DNA Sequence #4 ТАСАС СТTGG CGACT АСТ... What's the mRNA sequence? (Circle the change) amino…
A: DNA is two stranded structure which make it own strand via replication process . It comprises of…
Q: Please answer them correctly - Please answer all of them, they are connected. MUTATION Fill in the…
A: Introduction DNA is an organic molecule that includes genetic information as well as instructions…
Q: The presence of a polyA tail in eukaryotic mRNA helps protect the mRNA from degradation. true/false
A: The poly-A tail is long chain consisting of adenine nucleotides which is added to mRNA molecule…
Q: Select all the possible mutation types for the following observed phenotype resulting from a…
A: Mutation: Normal DNA contains a particular sequence of DNA. If the sequence of DNA is changed due to…
Q: If the nonsense mutation is in the last exon of the mRNA, the result would be: nonsense-mediated…
A: In genetics, a mutation is defined as a change or alteration in an organism's DNA sequences,…
Q: b. Translation translation is the process of generating polypeptide using the information carried on…
A: Flow of information in the DNA involves DNA RNA and proteins. Proteins are the ultimate machinery…
Q: Translation. Write the anti-codon sequence of the mRNA transcript. Translate the MRNA transcript…
A:
Q: Biol370 - Assignment #2 – Spring 2020: Replication - Transcription - Translation Due 3/10/2020…
A: To fill the table
Q: b. FALSE Unanswered a Save 58 What segments of the pre mRNA comprise the coding region? pre-mRNA 5'…
A: Introduction :- When an RNA transcript is first produced in a eukaryotic cell, it is referred to as…
Q: Do you think it matters which protein is mutated? Is one protein more important than another? How…
A: Exons and Introns are the regions of mRNA, while maturation of mRNA (splicing) the Exons are kept…
Q: The polyamines spermine and spermidine have numerous effects on both prokaryotic and eukaryotic…
A: Polyamine is a compound which has more than two amino groups.
Q: If the nonsense mutation is in the last exon of the mRNA, the result would be: nonsense-mediated…
A: When an mRNA is transcribed from the DNA template to carry the genetic information to the cell…
Q: INSTRUCTION: Given the DNA sequence below, provide the answers to the following items. a.…
A: In cells, DNA is present as genetic material that codes for mRNA, and mRNA in turn codes for the…
Q: A mixed copolymer was synthesized using 2 parts Cytosine and 1 part Adenine and the resulting mRNA…
A: In this question we have to describe about codon and its translating amino acids. See full answer in…
Q: Define the following terms:a. nascentb. signal hypothesisc. posttranslational modificationd.…
A: Introduction: After the process of transcription of DNA to RNA in the cell's nucleus, ribosomes in…
Q: An extra piece. In one type of mutation leading to a form of thalassemia, the mutation of a single…
A: Genetic code is read in the form of triplets.so first we will convert these to 3 codes and then…
Q: The genetic code was solved partly by the use of in vitro systems to translate synthetic RNAs into…
A: According to the genetic code, a set of three nucleotides, that isis the triplet code for a…
Topic is central dogma of molecular biology
Question:
4. Assuming the translation product is an enzyme, explain its role in the final expression of a
Please explain it to me thank you
Step by step
Solved in 3 steps
- Good afternoon, Guidance with this question would be most appriciated. Thank you for your time. Polypeptide sequences are formed from 20 amino acids. What is the probability that a single point mutation in a gene will result in a different polypeptide sequence?Only answer please, no need to explain… Thank you for your time. i: Modification of the 5 prime ends of eukaryotic mRNA is called? a) Capping b) Polyadenylation c) Splicing d) Transcription ii: Genetic Code is? a) The sequence of Nitrogenous Bases in mRNA that codes for a protein b) Is a Triplet Code c) is Non-Overlapping d) All of these iii. The process of formation of RNA is known as a) Replication b) DNA repair c) Translation d) Transcription iv. Which of the following statement is NOT true regarding transcription/RNA synthesis? a) RNA synthesis occurs in the nucleus b) Unlike DNA synthesis, the only selective sequence of DNA is transcribed to RNA c) RNA synthesis requires a short stretch of RNA primers d) DNA sequences, specific proteins, and small RNAs regulate RNA synthesisINSTRUCTION: Given the DNA sequence below, provide the answers to the following items. a. complimentary DNA strand 1.) G A A A T G A C C A G A T T T A T G G C C T G A 2). A T G C G A C C T T A A G T C A A T T G C G A C b. mRNA 1.) G A A A T G A C C A G A T T T A T G G C C T G A 2). A T G C G A C C T T A A G T C A A T T G C G A C c. protein synthesized 1.) G A A A T G A C C A G A T T T A T G G C C T G A 2). A T G C G A C C T T A A G T C A A T T G C G A C
- Instructions -Answer thr Questions properly. MUTATION: Fill in the correct nucleotide base pairing and amino acid sequence of the mutated DNA "MUTATED DNA" (SEE IMAGE) a. What is the 3’-5’ DNA sequence? (FORMAT: XXX-XXX-XXX-XXX-XXX) b. What is the mRNA sequence? (FORMAT: XXX-XXX-XXX-XXX-XXX) c. What is the tRNA sequence? (FORMAT: XXX-XXX-XXX-XXX-XXX) d. What is the amino acid sequence? (FORMAT: XXX-XXX-XXX-XXX-XXX) e. What is the most convincing type of mutation had occurred? - Substitution - Missense (Frameshift resulting Missense; Frameshift resulting Nonsense; Substitution – Silent; Substitution – Missense; Substitution – Nonsense)Need help answering these questions: Looking at the picture attached, Notice the indel symbol at location 296 of the query. What is the corresponding amino acid in the subject? How many nucleotides were inserted/deleted here?Question. Rewrite the following sentences after correction. (Subject: Biotechnology) The variation in the length of tandem repeat of microsatellite DNA has serious translational affects as this is due to its coding region. Correct: If one parent has sickle cell anemia and other has carrier genotype than there is 25 % chance that any offspring is carrier. Correct: Sickled WBC block the flow of blood and Calcium as they stick together and caused by frame shift mutation. Correct: The N1303K mutation in the CFTR gene of CF patients is autosomal dominant disorder due to insertion of asparagine at 1303. Correct: If a person RBCs have B surface antigen and it will clump with antigen B such clumping indicates Blood type B. Correct: Indirect ELISA can detect polygenic gene expression. Correct:
- Original sequence: Consider the following coding 71 nucleotide DNA template sequence (It does not contain a translational start): 5’-GTTTCCCCTATGCTTCATCACGAGGGCACTGACATGTGTAAACGAAATTCCAACCTGAGCGGCGT GTTGAG-3’ Question: 4) In a mutant you discovered that the underlined nucleotide has been deleted. What would the resulting peptide sequence be? What type of mutation is this? 5’-GTTTCCCCTATGCTTCATCACGAGGGCACTGACATGTGTAAACGAAATTCCAACCTGAGCGGCGT GTTGAG-3Problem B. DNA: Codon SegmentingThe way that DNA is often interpreted as genes is in groups of three nucleotides at a time, called “codons.” Thus, the DNA strand dna_str = 'agctttcattctgac' Can be broken into codons in the following three ways: agc ttt cat tct gac a gct ttc att ctg ac ag ctt tca ttc tga c # reading frame 0 # reading frame 1 # reading frame 2 Notice that in these lines, we start reading codons at string indexes 0, 1 and 2. The three different start indices are known as reading frames, and are called reading frame 0, reading frame 1 and reading frame 2, respectively. It is not always clear which of these frames will be read by genetic transcription mechanisms, so it is often useful to be able to be flexible and consider any of them when working with DNA strands. Write a function segment that takes as an input a string containing a DNA strand, and a reading frame (0, 1 or 2) to use. The function should return a list containing the sequence of individual codons. You…please help molecular biology technique Gene cloning & identification that have been used to study the protein Epidermal growth factor receptor I need to following using 1 journal article. please provide the link in the end i will appreciate it. and provide the answer in 1-3 paragraph per each part part 1 Detail the technique used to study this protein. part 2 What were the results reported for the protein using this technique (clear understanding of the set of results.
- Typed explanation only Codons in mRNA molecule and their corresponding amino acids UUU Phenylalanine UAU tyrosine UUA leucine UAA nonsense GCA alanine AAU asparagine AAG lysine UGC cysteine GUU valine UCG, UCU serine Refer to Table 8.2. If the sequence of amino acids encoded by a strand of DNA is serine-alanine-lysine-leucine, what is the order of bases in the sense strand of DNA? Group of answer choices 5' TGTGCTTTCTTA 3' 3' AGACGTTTCAAT 5' 3' UGUGCAAAGUUA 5' 5' AGAGCTTTGAAT 3' 3' TCTCGTTTGTTA 5'Need help:. Researchers add poly-(CGU) to an in vitro TL system. What poly-amino acids are produced? How would the researchers determine which codon encoded each of these amino acids? 5’CGUCGUCGUCGUCGUCGUCGUCGU...3’Instruction - Please answer them correctly - Please answer all of them, they are connected. MUTATION Fill in the correct nucleotide base pairing and amino acid sequence of the mutated DNA a. What is the 3’-5’ DNA sequence? (FORMAT: XXX-XXX-XXX-XXX-XXX) b. What is the mRNA sequence? (FORMAT: XXX-XXX-XXX-XXX-XXX) c. What is the tRNA sequence? (FORMAT: XXX-XXX-XXX-XXX-XXX) d. What is the amino acid sequence? (FORMAT: XXX-XXX-XXX-XXX-XXX) e. What is the most convincing type of mutation had occurred? (Frameshift resulting Missense; Frameshift resulting Nonsense; Substitution – Silent; Substitution – Missense; Substitution – Nonsense)
