A Moving to another question wil save thes responseQuestion 28Multiple Answer Question:Which of the following statements about the Watson-Crick model of DNA structure (also called the B-form of DNA) isiare TRUE?OA The bases of two nucieotides in a base-pair are held together by covalenit bonds.O8. The base pairing of nucleobases occurs on the inside of the double helox,OC The two DNA strands run antiparallel in the opposite directionsOD. Tne sugar phosphate backbone is located on the outside of the double holioxCIE The two DNA strands have identical nucleotide sequencesOF. The double helix is night-handed

Deoxyribonucleic acids or DNA is a type of nucleic acid present in the nucleus of the cell. It is…

Answered: Question 28 Multiple Answer Question:…

Biochemistry

9th Edition

ISBN:9781319114671

Author:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Publisher:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Chapter1: Biochemistry: An Evolving Science

Section: Chapter Questions

Problem 1P

See similar textbooks

Similar questions

Which of the following DNA double helices would be more difficultto separate into single-stranded molecules by treatment withheat, which breaks hydrogen bonds?A. GGCGTACCAGCGCATCCGCATGGTCGCGTAB. ATACGATTTACGAGATATGCTAAATGCTCTExplain your choice.
Given the choices,a. 25b. 18c. 23d. 21how many hydrogen bonds are present in a DNA double helix fragment consisting of the following sequence in one strand: ATTGCGGTCA
I have this textbook question in my grade 11 bio and it has me really confused as to where to start. Any help would be much appreciated Examine the following DNA sequence and determine what type of mutation, if any, produced the sequences below: ...TAACGCATIT... (a) ...TAGGART... (b) ...TAG CAST... (c) ...TAG CATTLE... (d) ...TACGCA GT TT...
if this DNA has a molecular weight of 1.20 ×108 Dalton which contains a head in a about 200 nm long. Calculate the length of the DNA assuming the molecular weight of a nucleotide pair is 600 Dalton and assume that the DNA is a B-form and that there are 10 base pair per turn which makes is 34 Å per turn. ( 1nm = 10Å)
Describe the theoretical structure for deoxyribonucleic acid. Specifically, describe the attributes (features) of the Watson and Crick model for DNA. I cant figure out where to begin this for my homework.
Problem B. DNA: Codon SegmentingThe way that DNA is often interpreted as genes is in groups of three nucleotides at a time, called “codons.” Thus, the DNA strand dna_str = 'agctttcattctgac' Can be broken into codons in the following three ways: agc ttt cat tct gac a gct ttc att ctg ac ag ctt tca ttc tga c # reading frame 0 # reading frame 1 # reading frame 2 Notice that in these lines, we start reading codons at string indexes 0, 1 and 2. The three different start indices are known as reading frames, and are called reading frame 0, reading frame 1 and reading frame 2, respectively. It is not always clear which of these frames will be read by genetic transcription mechanisms, so it is often useful to be able to be flexible and consider any of them when working with DNA strands. Write a function segment that takes as an input a string containing a DNA strand, and a reading frame (0, 1 or 2) to use. The function should return a list containing the sequence of individual codons. You…
Hello, I would really appiarte help appreciate help. This is a blank question so I am unsure why it was rejected immeditely the first time. Thank you in advance. Identify the type of mutation and how it would affect the protein made (amino acid) if the following changes occurred in the DNA antisense strand First codon change from TAC to TAT. Third codon change from ACG to ACA. Ninth nucleotide changes from G to T. Nucleotide with adenine (A) base inserted between 3rd and 4th nucleotide. Types of Mutation Changes in the Amino Acid 1. 2. 3. 4.
https://youtu.be/8kK2zwjRV0M Describe the purpose or theme of the video. Question 2 What are the chemical components of a DNA nucleotide? Question 3 List three characteristics of the structure of the DNA molecule. Question 4 Suppose you have a 5'-AGAGTGCGTA-3' sequence on one strand of the DNA. What is the base sequence that should appear on the other complementary strand of the DNA?
Let’s return to your patient with sickle cell anemia. Below is the RNA sequence from your patient and from her mother. (The ••• represents another 30 nucleotides not written out here). The affected nucleotide is indicated in BOLD. Patient’s RNA: 5’ –CUAUGACAGAGUUC•••CAUUAGCCA – 3’ Mother’s RNA: 5’ –CUAUGACAGUGUUC•••CAUUAGCCA – 3’ A) Write out the first 10 nucleotides corresponding to the DNA sequence of the coding strand for your patient in the 5' to 3' direction. B) From the information you have been given, why is it not possible to accurately write out the DNA sequence as it would really be found in the genome? (ie, what you wrote down in part A is NOT necessarily what the DNA sequence would really look like if we could examine the chromosome directly - why? And no this has nothing to do with the 30 nucleotides that aren’t written out or the mutated base). Your answer should be 1-2 sentences maximum.
The introduction to this chapter, which describes the sequencing of 4000-year-old DNA, emphasizes DNA’s extreme stability. What aspects of DNA’s structure contribute to the stability of the molecule? Why is RNA less stable than DNA?
In the Watson-Crick model of DNA structure: Question 5 options: T can form three hydrogen bonds with either G or C in the opposite strand the distance between two adjacent bases in one strand is about 3.4 Å both strands run in the same direction, 3' -> 5'; they are parallel the distance between the sugar backbone of the two strands is just large enough to accommodate either two purines or two pyrimidines phosphate groups project toward the middle of the helix, where they are protected from interaction with water
no explanation necessary! Letter of answer only. Part I: Multiple choice 1. The DNA base pairing rules are: a) Any combination of the bases. b) T pairs with C, and A pairs with G. c) A pairs with T, and C pairs with G. d) C pairs with A, and T pairs with G. 2. DNA in cells is damaged: a) Millions of times a day. b) By collisions with other molecules or by chemical accidents and radiation. c) Not very often¸ and by radiation only. d) a and b 3. For genes that code for proteins, which molecule conveys the information from the gene to the ribosome? a) DNA b) mRNA c) tRNA d) rRNA 4. Which of the molecules below is produced during replication? a) mRNA b) rRNA c) tRNA d) DNA 5. Why is there a difference between the synthesis of a lead strand and that of a discontinuous strand in DNA molecules? a) The origins of replication are found only at end 5' of the molecule. b) Helicase and protein factors act at the extremity of 5'. c) DNA polymerases can only add new nucleotides at the extremity 3' a…

SEE MORE QUESTIONS

Recommended textbooks for you

Biochemistry

ISBN:

9781319114671

Author:

Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Publisher:

W. H. Freeman

Lehninger Principles of Biochemistry

Biochemistry

ISBN:

9781464126116

Author:

David L. Nelson, Michael M. Cox

Publisher:

W. H. Freeman

Fundamentals of Biochemistry: Life at the Molecul…

Biochemistry

ISBN:

9781118918401

Author:

Donald Voet, Judith G. Voet, Charlotte W. Pratt

Publisher:

WILEY

Biochemistry

ISBN:

9781319114671

Author:

Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Publisher:

W. H. Freeman

Lehninger Principles of Biochemistry

Biochemistry

ISBN:

9781464126116

Author:

David L. Nelson, Michael M. Cox

Publisher:

W. H. Freeman

Fundamentals of Biochemistry: Life at the Molecul…

Biochemistry

ISBN:

9781118918401

Author:

Donald Voet, Judith G. Voet, Charlotte W. Pratt

Publisher:

WILEY

Biochemistry

ISBN:

9781305961135

Author:

Mary K. Campbell, Shawn O. Farrell, Owen M. McDougal

Publisher:

Cengage Learning

Biochemistry

ISBN:

9781305577206

Author:

Reginald H. Garrett, Charles M. Grisham

Publisher:

Cengage Learning

Fundamentals of General, Organic, and Biological …

Biochemistry

ISBN:

9780134015187

Author:

John E. McMurry, David S. Ballantine, Carl A. Hoeger, Virginia E. Peterson

Publisher:

PEARSON

SEE MORE TEXTBOOKS